Transcript

p2rx3b-201

ID
ZDB-TSCRIPT-090929-6871
Name
p2rx3b-201
Previous Names
  • p2rx3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023934 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023934|OTTDARG00000019475|ZDB-GENE-030319-3 p2rx3b|OTTDARP00000019825 p2rx3b-001 LG_ BX511158.5 Danio rerio protein_coding KNOWN, 2930 bp
AGTGACATTTTAATAGGCAAACAAACACGGAGGATTATTG
AAGAGGTTTTGGACTTTTATCTACAAAAAGCAGGATAAAG
CAACTAGACGGATTCGCCACCAGCATTGATTATATTCTTA
ATTGCAAAATCACACAAATATATTGATACACTTGGAGTGT
CATTTTTGTGAATGCAGCAGTGCTCTGGAAAAATGTGGAC
CTGTATAACAGATTTCTTTACATATGAGACTACCAAGTCT
GTGGTGGTAAAGAGCTGGACCATCGGCATCATCAACCGGG
TCGTGCAACTCCTCATCATCACATACTTCATCGGCTGGGT
GTTTTTGTATGAGAAAGCATATCAAGTGAGAGACACGGCC
ATCGAGTCTTCAGTCATGACTAAAGTCAAAGGCTTTGGGG
AGTACAACAACCGCATCATGGATGTGGCAGATTATGTCAC
ACCTACTCAAGGGGCGTCGGTGTTCTGCGTCATCACTAAA
CTCATCACCACAGAAAACCAAGTTCAGGGAAACTGTCCAG
AGAGCGAGTTGAAATTCAAATGTGAGAATGACATTAGATG
TAAGCAGCTGATGACAAAACCATCTAGTAATGGGTTGCTG
ACGGGGCGGTGTGTGCACTTTAATACAACTCACAAAACTT
GTGAGATCAAAGGATGGTGCCCTGCAGAGATTGACGAAGT
CCAGCCAAACCCCATGATGGAGGTGGAGAACTTCACCATA
TTTATCAAGAACAGCATTCGCTTCCCACGTTTTAACTTCA
CCAAGGGAAACTTTTTGGCCAACATCAACAGTTCATACAT
AAAGGGATGTAATTTTGACTTTGAGAGGAACATGTATTGC
CCGATATTCAAAGTGGGGGATGTGATCCGATTCGCCCAGC
AAAACTTTACCACTCTTGCTACAAAAGGGGGAGTGATAGG
AATAAAAATAGCCTGGGTGTGTGATTTAGACAAGGCAGAT
GATGAGTGTAAGCCTGCCTATTCCTTCACCCGTCTTGACG
CCATGTCAGAGAAGACCACCGTTTCTCCAGGATACAACTT
CAGGTACGCTAAGTATTTTAAAATGGAGAACGGAACTGAG
TATCGCACTCTGCTGAAAGCCTACGCCATCAGATTTGATG
TGCTGGTCAATGGAGATGCAGGAAAATTTGACATGATCCC
AACTCTAATCAACATGGTGGCTGCTTTCACCTCTGTTGGT
GTGGGTACAGTGCTTTGCGATATCATTTTGCTGAACTTCT
TGAAAGGAGCAGACCAATATAAGGCCAAGAAATTTGAAGA
GGTGTCAGATTCAAATATTCAAAGCTCTGGTTCACTGTAC
AGGACCAGAGACCACAGCCAGCAGTCCATCAAAACCGACG
AGAAGTTCTCCAACGACTCCGGCGCCTTTTCCATCGAACG
TTACAGCTAATAATGCTAATCACAGGATTGAAATGAGTCG
ATTTGTAACATTATCATTTCTTCATCAAGTCATCGCACTT
AATAATCTTTGTCATTGTCATTAATGATTTAGCATTATTT
TGAACTAACCCTTAAACTTTACACACAAAACAGACTAAAC
GCAGGGTGCGAAATGCGAATTACAGGGGGGTAATCCTCCT
CCTAATTAACGCTTGATCCCCCTGAAGGACGTCAAAACAA
GATGTATGCAGGATCAGCCCTTTAATACTGAAAATTATTT
CCGTCTGATCTGTATTTTATATAATTAAAATTGATTATTA
AAATAATAGATCAAATAAAACACATTTGAACACCCCTATA
ACGGTTCATACCATTGTGAATGCATAATCGCGCCAAATCA
GTTTTGCGGGGAAAATATTCGGGGAAAATACAGTCTGAAA
CTGCAGATGTGGCCCACCGATAGACATCGTAAGTGTTTAA
AAGACTGTTTTCTCGAAAAATAGGAGTTTGTTTCTACATA
CAGCCTTAAAGTAATGTCAAATTAGATGCATAGTTTGTAT
AATATGACCTTCAGTAACTTCTAAAATAGTTTATCAGGGG
CTAACGTTAATTTACTGTGGGGCAGAATACTCGAAATATT
CGCCTAAACACTGCAAACCTAAAGACGTTTTTATCAATAA
ATTAGGTATAATGTAAATAAATACATAAATTTGATTCACT
AAATTCCCAAACATTACCGAAAAGGTTGACCCTTCCGATC
GTATATGTATAATTCGCACCTCAACTAACGTTAAACGACT
ACATTTCCTACATTTTCCTTAACCATGAAAAATATTTTAA
TTATAACCATGTCCCAAATGCTAATTGTTAAAATTAAACT
CAGTCAAAATATACTATATGACTAATCAAATATCTAAAAT
AGTACTTTATTTTGTAAATAATAGCATTAAGTACATACTT
AAATTATGTGATGTATGCTTATAGTGTTTGCATGGCCTTT
ACACAACAGCAGTTTAATAATTATGTCACTGTTCAATAGA
TACACATGCAGATGTGTTTTATGTGTTGTATGTTTAACAG
TTTTTTTTTTTTTTTATCAAACTCTAAAATAAAAATAGTT
TACCCACAAATAAGATTTACTCACAAATTACTACCCCTCA
AGCGGTTACTAATCTATGAATTTTCTGTTGAACACGAAAG
AAAATATTTTGAAGAATCAAGCTGGTAATCAAGCATTAAT
ATCCATAGTAAATGGGACTGCTATGGTAGTCACTAGCTAC
AGCTTTCCAACATTATTCAATTGAGCTTTTTGTGTTCAAC
TGGACAGACAAAAAGTAAAGTGTGAGTAAATGATTGATTT
TGTTTGCGGATGAAATCTTAATTACGTGATTTTAGATTTC
TTTTATACTTCTGTTTGTACTACTAAATTTCAATATGCTT
GTAAATATTGATGCAGGTCATTGAGAGGCTCAGGGCAATA
AAAACACATGTACTTGTCATTTCTGATGTGAATAAATGGA
TTTCTCTTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations