Transcript

irx1a-201

ID
ZDB-TSCRIPT-110325-111
Name
irx1a-201
Previous Names
  • irx1a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047910 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047910|OTTDARG00000033970|ZDB-GENE-040707-1 irx1a|OTTDARP00000037599 irx1a-002 LG_ FO704818.1 Danio rerio protein_coding KNOWN, 1656 bp
TCTGATCACATCCGACGGACTTGCTGCAGAAGAGAAGCTG
AGATTTAAAGACGAGCGCTTTCCCGTTCGCTTTTCAGAGA
GAGAGAGAAACTCTTGCACTTCTCGCTTTGGTGGGTTATT
TGCTTTTTTGCCTGGTTTTGGCTTCCGACGTGGCGGAGGA
GATGTCTTTCCCCCAGCTGGGCTACCCGCAGTATTTAAGT
GCCTCCCAGGCGGTGTACGGAGGCGACCGACCGGGAGTTC
TGACTCCGTCGTCCCGCGCAGGGAGCGCTGAGATCGGGGG
TAGCGCGTCTGCGGCCGCCGCTGCGGTGTCCTCGGTGTTG
GGCATGTACCCGTACGCACACAACTACAGCGCCTTTCTGC
CTTACACCAGCGCCGATCTGGCTCTTTTCTCCCAAATGGG
CTCTCAGTATGATCTGAAAGACAGCCCTGGAGTCCACCCT
GCCAGCTTCGCTGCCCACACGAGTCCTGCCTTCTACCCCT
ACGGCCAGTTCCAGTACGGAGACCCCGCCAGGCCCAAAAA
CGCCACCCGGGAGAGCACCAGCACCCTGAAGGCCTGGCTG
AACGAGCACAGGAAAAACCCCTATCCCACCAAAGGAGAGA
AGATCATGCTGGCCATCATCACCAAGATGACCCTCACGCA
AGTGTCCACCTGGTTCGCCAACGCTAGAAGGAGACTCAAG
AAGGAGAACAAGGTGACCTGGGGCGCCAGGAGCAAGGACG
ACGAGAACATTTTTGGAAGCGATAACGAAGGAGACGCCGA
AAAGAACGAGGACGAAGAGGAGATAGATCTGGAGAGCATA
GATATCGATAAAATCGACGACAACGATGGCGATCAGAGCA
ACGAGGAGGACGAGGACAAGCGCGCGGAGCTGGAGAGCCT
CCAGGAGAAGCGACACGCGTCCAAAGAGCCGTCGGATGGC
AACAACAACACCACTAGAGTACTGTCGCCCGGTCGACAGG
GCGGTTTTCAAGTTCCGGTTAGCAATAAGCCCAAAATATG
GTCGTTGGCAGAAACAGCGACCAGTCCCGATAGCGCGCAG
AAACCTACGTCACCTTCCGTTCCCGTCAGCCACCCGGCCT
TCCTGCCCAGCCACGGACTGTACACGTGCCAGATCGGCAA
GTTCCACAACTGGACGAACGGCGCGTTTCTGGGACAAAAC
TCTCTGCTAAATGTGCGCTCTTTCCTGGGCGTCAACCAGC
ACAACCACCCGGCGCAGCAGCAGCAGCAGCAGACGGGGCC
CGCGTCCCTGCAGGTGCTGTCGGCCGGGAACACGGACAAG
ATGCCGGAGGACCTGAGTCCAAAACACATAGTCCCAGAAA
CCAGCAGGAATCAACACAGAGGGTCCTCACAGCGCTGTCC
TCCGCTTGATCAACACATTTGCACCCCCAAAAGGACTGAT
GGCACTAATAATGGACACTGAAAGCGAAATCAATTCAGCG
TAGCGTTGAGTCTCTCTAAAACAACCGGCCGCTGGAGTTG
TACATAATGACACCTGTGATCCCTCCCTTACCGTGGGACA
TTGGTAGGCGTACTTTGTCTTTATGTGTTGGTGTTTTCCT
TTAAGGTGACCCACCATTTGTAAATAGCGAGTTGACGGAG
TTTGTCCAGATCATATATTTTGTCTAATAAACTAAATGAA
ATTATAGACACATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations