Transcript

fyna-201

ID
ZDB-TSCRIPT-110325-1089
Name
fyna-201
Previous Names
  • fyna-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048129 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048129|OTTDARG00000034094|ZDB-GENE-030903-5 fyna|OTTDARP00000037769 fyna-001 LG_ CU306817.11 Danio rerio protein_coding KNOWN, 3215 bp
ATCTGTTACACTCGGCGACAGGAGCAGCCTGAACCGTCAG
GGCCAATGTTGTTATTTTCATAATTCACCGAGATTTTATT
AATAGAAGAAGCCGTCTGCAAATGACCTATTTTCGATTCT
CTCTTTGCGGTGAAACACAAACACACTTCAGGCGACCCCT
CTCTTGGCAAAGGAGCAAATCATAGATGTTTTCACCCCAT
CTTTAATTGAATGGAATGCGAATACTCCACTGTGGTAGCC
CAGTGCTTGCCTTGAATATAGATAATGGGCTGTGTGCAAT
GTAAGGACAAAGAGGCAACCAAACTCACAGACGAAAGAGA
AACTAGCGTCTCGCAGCATGCGGGATATCGATATGGGTCT
GATCCGACTCCTCAGCACTACCCCAGCTTTGGAGTCACCG
CCATTCCCAACTACAACAACTTCCATGCGCCTGTCAGTCA
GGGAGTGACCGTGTTTGGTGGAGTGAACTCATCGTCGCAC
TCGGGAACGCTACGATCCCGGGGAGGAACAGGAGTCACAC
TCTTTGTAGCACTTTATGATTATGAGGCAAGGTCAGAGGA
TGACCTGAGCTTCAGGAAAGGGGAAAAGTTCCAGATTTTA
AATAGCACGGAAGGAGACTGGTGGGAGGCACGCTCTCTCA
CTACAGGTGGAACAGGATACATACCCAGTAATTATGTGGC
TCCAGTCGACTCCATACAGGCAGAAGATTGGTACTTTGGA
AAACTAGGCCGTAAAGATGCAGAACGACAACTGCTGTCAA
ATGGAAATCCCAGAGGCACTTTCCTTATAAGGGAGAGTGA
GACCACGAAAGGAGCATATTCATTGTCCATACAGGACTGG
GATGAAACTAAAGGCGACCATGTGAAGCACTACAAAATAC
GAAAGTTGGACAATGGAGGATATTACATCACCACTAGAGC
TCAGTTTGAAACTCTTCAGCAGCTTGTGCACCATTATTCA
GCCCGGGCTGCAGGACTTTGTTGCCGTTTAATAGTCCCAT
GCCATAAAGGCATGCCCCGCCTCGCAGACCTGTCCGTCAA
AACCAAAGATGTATGGGAAATCCCACGGGAGTCACTTCAG
CTCATCAAACGATTGGGGAATGGACAGTTCGGAGAGGTCT
GGATGGGCACTTGGAACGGCAACACTAAAGTGGCAGTGAA
GACCTTGAAACCAGGCACAATGTCCCCAGAGTCATTCCTG
GAGGAGGCTCAGATAATGAAGAAACTGAGGCATGACAAGC
TGGTGCAGCTGTATGCGGTCGTCTCTGAAGAACCCATCTA
CATTGTGACAGAATATATGAGCAAAGGAAGTCTGTTGGAC
TTCCTGAAGGATGGTGAAGGACGTGGGCTTAAATTGCCAA
ATTTAGTCGACATGGCTGCTCAGGTTGCTGCTGGCATGGC
TTACATCGAAAGGATGAACTACATCCACAGAGATCTGCGG
TCTGCCAATATACTTGTTGGGGACAGCTTAGTGTGCAAGA
TTGCAGATTTCGGACTGGCCAGACTAATAGAAGACAATGA
ATACACAGCACGACAAGGTGCCAAGTTCCCAATAAAGTGG
ACGGCTCCAGAAGCAGCGCTCTACGGACGGTTTACTATCA
AGTCAGACGTGTGGTCATTTGGAATACTACTCACTGAGCT
GGTCACCAAAGGACGTGTGCCCTATCCAGGCATGAACAAC
CGGGAAGTCTTGGAGCAAGTGGAGCGTGGTTACAGGATGC
CTTGCCCTCAGGACTGTCCCAGCTCCCTGCATGAGCTCAT
GCTCCAGTGCTGGAAGAGGGACCCCGAAGAGCGGCCCACC
TTTGAGTATCTGCAAGCCTTCCTGGAGGATTACTTCACTG
CCACTGAACCACAGTACCAACCCGGGGACAACCTCTAAAC
ACAGAGCCCCAGTGTGCCACAACAGACTGCCCTACAAAAA
AAAGACTGAGCGTTTGATGAGTGAAGCTTCCAGGTTTTGT
GCCATCTTGACCCAATCCATCTTCCATTGACGAAAAAAAC
AAAACGGACATGCGATCGCATTTTATCTGTCAGTAAAGCC
AAAAATAGTATTCCGGGGAGACGTCCATCACGATTAATGA
TAAGAAAGGCTTGTTTGTATGTAGTGTAAATAGTGTGTTT
AGTTTTCCCTTGTATTTGGCTTGTTTTATTACTTTTTATA
ATGCTGTTTTGCGTTCTTATCCAGGCCGAGGAAAAAAAAA
AGTCGACGCTGTGAGGAAAGTACGACCAACAGATCAACCG
TTTTAATATTCCCGACGATTCTGGACATCCTTGACACTTC
CAGTAGGACGTTGACCAGCCTCTTTTAAACCTTAAATGAA
TTCTGTCAATTGTACATTGAATTAACTGAACGTGTCAACA
ACAAAAGACATACAGCAGTGCATAGGTAGCATTTCTGACA
CATTATTGTGGGTTTTCACAGAAGGTAATGACGTCCGCAC
TGGTTTTAGTGAGTTTGCTGGGCCTGATTATTTTGCACCC
GCTCAGTGTGTCTCTCTTTTCGTTTTCTGCTTCTTAGGAC
GAGTGCATTTTCTATTTAGTCACTTTGGATTAACGATAGA
GCAATGTATGTATCAGAATAGTACGAGACCAAGTGGGCAT
TATGCTTGACCATAACTGCATCTTTCCTGCAAATAAGATA
AAATGACTGCTAACATACCTTACTGTTGTGAGAGAAAATA
AAAAGTCCATTCAGTGTATCTCACAATATCATGCATTATA
AAATAACACGACTAAACGCGTAGAGAAATATTATCAAATT
GTAGAACTTCACTCAAGATAACTCTCATCGCTGGGCTGCC
TTGTTTTTTTGCCCCTCGTTTTCTCTTTTACGATAAAACG
ACATGTCTGAATATTCATTACTGGGTGATTCTTTGCTTTT
TTAACACGTTAAGGAATCGTCTGTGAACATAGTCAATGCG
ACGGTATTGGCATGAGCCATATTTCAAGAGTGGTCGTTTT
GCTACTCTTTACATTTTCGTTGTTGATTTCAGTCAATATT
TTGGATAGGATAAGGGGTTTTAACCGAAGGCTGCTTTGAT
CTGGGCCTATCGTTTTAATGATGTGCTGCATTTGTGTTCC
AACCTCATAAGTTTTTCACATTTATTTTTGTACCATCTAT
GTTTGGATTAATTCATAAATCTTGTGTTTATTTAATTGCT
TCCTTTCATTTATGCACAAAAACATTTTTAGAATAAAGTG
TCATATTCAAAATCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations