header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1089
Transcript Name: fyna-201
Previous Name: fyna-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048129 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048129|OTTDARG00000034094|ZDB-GENE-030903-5 fyna|OTTDARP00000037769 fyna-001 LG_ CU306817.11 Danio rerio protein_coding KNOWN, 3215 bp
ATCTGTTACACTCGGCGACAGGAGCAGCCTGAACCGTCAG
GGCCAATGTTGTTATTTTCATAATTCACCGAGATTTTATT
AATAGAAGAAGCCGTCTGCAAATGACCTATTTTCGATTCT
CTCTTTGCGGTGAAACACAAACACACTTCAGGCGACCCCT
CTCTTGGCAAAGGAGCAAATCATAGATGTTTTCACCCCAT
CTTTAATTGAATGGAATGCGAATACTCCACTGTGGTAGCC
CAGTGCTTGCCTTGAATATAGATAATGGGCTGTGTGCAAT
GTAAGGACAAAGAGGCAACCAAACTCACAGACGAAAGAGA
AACTAGCGTCTCGCAGCATGCGGGATATCGATATGGGTCT
GATCCGACTCCTCAGCACTACCCCAGCTTTGGAGTCACCG
CCATTCCCAACTACAACAACTTCCATGCGCCTGTCAGTCA
GGGAGTGACCGTGTTTGGTGGAGTGAACTCATCGTCGCAC
TCGGGAACGCTACGATCCCGGGGAGGAACAGGAGTCACAC
TCTTTGTAGCACTTTATGATTATGAGGCAAGGTCAGAGGA
TGACCTGAGCTTCAGGAAAGGGGAAAAGTTCCAGATTTTA
AATAGCACGGAAGGAGACTGGTGGGAGGCACGCTCTCTCA
CTACAGGTGGAACAGGATACATACCCAGTAATTATGTGGC
TCCAGTCGACTCCATACAGGCAGAAGATTGGTACTTTGGA
AAACTAGGCCGTAAAGATGCAGAACGACAACTGCTGTCAA
ATGGAAATCCCAGAGGCACTTTCCTTATAAGGGAGAGTGA
GACCACGAAAGGAGCATATTCATTGTCCATACAGGACTGG
GATGAAACTAAAGGCGACCATGTGAAGCACTACAAAATAC
GAAAGTTGGACAATGGAGGATATTACATCACCACTAGAGC
TCAGTTTGAAACTCTTCAGCAGCTTGTGCACCATTATTCA
GCCCGGGCTGCAGGACTTTGTTGCCGTTTAATAGTCCCAT
GCCATAAAGGCATGCCCCGCCTCGCAGACCTGTCCGTCAA
AACCAAAGATGTATGGGAAATCCCACGGGAGTCACTTCAG
CTCATCAAACGATTGGGGAATGGACAGTTCGGAGAGGTCT
GGATGGGCACTTGGAACGGCAACACTAAAGTGGCAGTGAA
GACCTTGAAACCAGGCACAATGTCCCCAGAGTCATTCCTG
GAGGAGGCTCAGATAATGAAGAAACTGAGGCATGACAAGC
TGGTGCAGCTGTATGCGGTCGTCTCTGAAGAACCCATCTA
CATTGTGACAGAATATATGAGCAAAGGAAGTCTGTTGGAC
TTCCTGAAGGATGGTGAAGGACGTGGGCTTAAATTGCCAA
ATTTAGTCGACATGGCTGCTCAGGTTGCTGCTGGCATGGC
TTACATCGAAAGGATGAACTACATCCACAGAGATCTGCGG
TCTGCCAATATACTTGTTGGGGACAGCTTAGTGTGCAAGA
TTGCAGATTTCGGACTGGCCAGACTAATAGAAGACAATGA
ATACACAGCACGACAAGGTGCCAAGTTCCCAATAAAGTGG
ACGGCTCCAGAAGCAGCGCTCTACGGACGGTTTACTATCA
AGTCAGACGTGTGGTCATTTGGAATACTACTCACTGAGCT
GGTCACCAAAGGACGTGTGCCCTATCCAGGCATGAACAAC
CGGGAAGTCTTGGAGCAAGTGGAGCGTGGTTACAGGATGC
CTTGCCCTCAGGACTGTCCCAGCTCCCTGCATGAGCTCAT
GCTCCAGTGCTGGAAGAGGGACCCCGAAGAGCGGCCCACC
TTTGAGTATCTGCAAGCCTTCCTGGAGGATTACTTCACTG
CCACTGAACCACAGTACCAACCCGGGGACAACCTCTAAAC
ACAGAGCCCCAGTGTGCCACAACAGACTGCCCTACAAAAA
AAAGACTGAGCGTTTGATGAGTGAAGCTTCCAGGTTTTGT
GCCATCTTGACCCAATCCATCTTCCATTGACGAAAAAAAC
AAAACGGACATGCGATCGCATTTTATCTGTCAGTAAAGCC
AAAAATAGTATTCCGGGGAGACGTCCATCACGATTAATGA
TAAGAAAGGCTTGTTTGTATGTAGTGTAAATAGTGTGTTT
AGTTTTCCCTTGTATTTGGCTTGTTTTATTACTTTTTATA
ATGCTGTTTTGCGTTCTTATCCAGGCCGAGGAAAAAAAAA
AGTCGACGCTGTGAGGAAAGTACGACCAACAGATCAACCG
TTTTAATATTCCCGACGATTCTGGACATCCTTGACACTTC
CAGTAGGACGTTGACCAGCCTCTTTTAAACCTTAAATGAA
TTCTGTCAATTGTACATTGAATTAACTGAACGTGTCAACA
ACAAAAGACATACAGCAGTGCATAGGTAGCATTTCTGACA
CATTATTGTGGGTTTTCACAGAAGGTAATGACGTCCGCAC
TGGTTTTAGTGAGTTTGCTGGGCCTGATTATTTTGCACCC
GCTCAGTGTGTCTCTCTTTTCGTTTTCTGCTTCTTAGGAC
GAGTGCATTTTCTATTTAGTCACTTTGGATTAACGATAGA
GCAATGTATGTATCAGAATAGTACGAGACCAAGTGGGCAT
TATGCTTGACCATAACTGCATCTTTCCTGCAAATAAGATA
AAATGACTGCTAACATACCTTACTGTTGTGAGAGAAAATA
AAAAGTCCATTCAGTGTATCTCACAATATCATGCATTATA
AAATAACACGACTAAACGCGTAGAGAAATATTATCAAATT
GTAGAACTTCACTCAAGATAACTCTCATCGCTGGGCTGCC
TTGTTTTTTTGCCCCTCGTTTTCTCTTTTACGATAAAACG
ACATGTCTGAATATTCATTACTGGGTGATTCTTTGCTTTT
TTAACACGTTAAGGAATCGTCTGTGAACATAGTCAATGCG
ACGGTATTGGCATGAGCCATATTTCAAGAGTGGTCGTTTT
GCTACTCTTTACATTTTCGTTGTTGATTTCAGTCAATATT
TTGGATAGGATAAGGGGTTTTAACCGAAGGCTGCTTTGAT
CTGGGCCTATCGTTTTAATGATGTGCTGCATTTGTGTTCC
AACCTCATAAGTTTTTCACATTTATTTTTGTACCATCTAT
GTTTGGATTAATTCATAAATCTTGTGTTTATTTAATTGCT
TCCTTTCATTTATGCACAAAAACATTTTTAGAATAAAGTG
TCATATTCAAAATCC

fyna TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA fyna-201 3215
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fyna-201 Contained in:

OTHER fyna-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048129 (1)
  • Ensembl_Trans:ENSDART00000150232 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AJ620748 (1) 2082 bp
    GenBank:AY948197 (1) 1938 bp
    GenBank:CO358220 (1) 761 bp
    GenBank:CO356747 (1) 700 bp
    GenBank:CO356749 (1) 680 bp
    GenBank:EB938789 (1) 662 bp
    GenBank:CT583731 (1) 631 bp
    GenBank:CK680779 (1) 551 bp
    GenBank:AW281167 (1) 407 bp
    GenBank:AL915911 (1) 405 bp
    CITATIONS (2)