Transcript

ntrk3a-202

ID
ZDB-TSCRIPT-110325-102
Name
ntrk3a-202
Previous Names
  • ntrk3a-001
  • ottdart00000047876
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047876 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047876|OTTDARG00000033947|ZDB-GENE-010126-3 ntrk3a|OTTDARP00000037577 ntrk3a-001 LG_none CR352216.10,BX088695.9,CU855793.35,CU076078.7 Danio rerio protein_coding KNOWN, 13332 bp
TCTTCAAGCCGGAGCTCCAACAACCTGGAACTGCGCGACA
AACAGCACCGAGGAGAGGGGAAAGCTTTTACAATGCAGCC
CGTAGAGGAGGACAGCCTGGGAGCGTTGATTTTTGAGCCC
TTTCTACATTGACGGAGTATTTCCCCGTTTTCCTGGGGAC
GTTATTGCGATCTCATTGATCTGACATACCTTCACTCTCA
TCCACTCGCGCGCGCGCTCTCGCATCTGCGTACGGATTGC
AACCCGGAGCGCTCTCGACACCGCGTTCCCGCTAAACACT
ATAACCGAGCACCTGGAGACATGGATTTATTCTCCATCCC
GCCTCGCGTTTGCTTGTGGAGGATCCTGTTTCTCCTCAGC
ATCTTCCAAGATTATATGAGCTCCATGCTGGACTGCCCGC
CGACCTGCACTTGTTCTACCACGGACATCTTTTGCAATAA
GTCTTACCAAGGGAATTTCTTTCCCCTCCTGGCACTACAG
GACACCGTGAGCGACGGGAATACCACCAACAGCCTCCCGG
ACCTGTTTGAGAACATCTCCACCATACACATCGAGAACTG
GTCCTTGCAGACGTTGAAAGATCTTGACATGGAGTTGTAC
ACTGGGCTTCAGAGACTGAACATTGTGAACTGCAACTTGC
GTACGATCCAGTCGCGAGCCTTTGCTAAGAATCCCCACCT
GCGCTACATAAACTTGTCCAGGAATCCTCTGACAACTCTC
TCATGGCAGCTTTTTCAGAATCTGCAACTTTTGGAGCTGA
AACTGGAAGGAGTGGTGTTTAACTGCAGCTGCAATATCCG
ATGGATCCAGCTGTGGCAGCAGCGAGGCGAAGCCGGACTT
CATAACCAACAGCTGTTCTGCTTCAACGGATACTCCAAGA
TCCCTCTGCAGCTCATGAACATCTCGCAATGCGATTTTCC
CGAAATCAGCGTCAGTCATAGTAACCTGACAGTGACAGAA
GGTGACAGGGTCATGATCACCTGTAATGGATCAGGGATAC
CAGTACCGGAAGTGGATTGGACAGTTGGTGGACTACACTC
CATTAACACACACCAAGCCAATCAATATCCACCGAATGTC
CACTCCATCAACTTAACTCTGGTCAACGTCAGCCGGGACG
ATAACGGCTTCATGCTGACCTGCATTGCAGAGAATATAGT
CGGGATGACAAATGCCTCAATACAGCTTTCAGTGCAGTTC
CCTCCTGCCATCATTAACTTCGAGGAGCCGCAGAAGAGGC
ACGACACATGTATGATGTTCACGGTACGGGCCAATCCCCT
GCCAACCCTGCACTGGAGCTTCAAGGGTGAGGAGATCAAG
GCGACCGAGTACGTCCACCCAGAGATGGAGGTCTATCAGG
ACAATCTGGAGGGTTGCCTCTTGTTTAAAAACCCTACACA
ACACAACAATGGAAATTACACACTGGAGGCCAGAAACTAT
CTGGGCGTGGCCGTCAAAACTGTGTACGCCCACTTTCTAC
ACCCGCCTTTTGAAGACTACCCAGATTATGTGAGCCCAAC
TCCGACGGCTATTCCAACCATGACACATCGGCCTGAAGAG
GACACGTTTGGCGTGTCGATTGCGGTTGGCTTGGCTGGCT
TCGCCTGCGTTCTCCTCGTCGTTATGTTTGTGCTAATCAA
CAAATATGGCAGACGCTCAAAGTTTGGCATGAAAGGACCT
GTGGCTGTGATCAGTGGTGAAGAAGACTCTGCAAGTCCTC
TCCATCACGTCAATCATGGCATCATAACCCCGTGTACACT
GGACGCTGGACCGGACGCTGTGGTGATAGGCATGACTCGC
ATTCCAGTGATCGAGAACCCGCAGTACTTCCGACATGGGC
ACAACTGTAACAAGCCTGCTACTTATGTACAGCACATTAA
GCGTCGAGACATCGTGCTCAAGAGGGAACTGGGCGAAGGG
GCCTTTGGGAAGGTGTTCCTGGCAGAGTGTTACAACCTAA
GCCCCACTAAGGACAAGATGCTGGTGGCTGTCAAGACCTT
GAAGGATCCCACACTTGCGGCAAGGAAAGATTTCCAGCGT
GAGGCCGAATTGTTGACCAACCTTCAGCACGAGCACATAG
TCAAGTTCTATGGCGTCTGTGTGGACGGAGACCCACTCAT
CATGGTCTTCGAGTACATGAAACATGGAGACCTCAACAAG
TTCCTCAGAGCTCATGGTCCAGATGCCATGATCCTGGTTG
ACGGACAGCCGCTACAGACCAATGGAGAGCTGGGCTTGTC
TCAGATGCTGCACATCGCCAGTCAGATCGCATCAGGGATG
GTTTACCTGGGCTCTCAGCACTTCGTGCACCGCGACCTGG
CCACACGCAACTGCCTGGTGGGGAATGGGCTGCTTGTGAA
AATAGGAGACTTTGGGATGTCGAGAGACATTTACAGCACT
GACTACTACCGGGTAAGAGAGGTGGGAGGACACACTATGC
TGCCCATTCGCTGGATGCCACCAGAAAGCATCATGTACAG
GAAGTTCACGACGGAGAGTGACGTGTGGAGTTTTGGGGTC
ATCCTCTGGGAAATATTTACCTACGGCAAGCAGCCATGGT
TTCAGCTGGCAAATAATGAGGTAATCGAATGCATCACACA
AGGACGGGTGCTAGAAAGGCCACGGCTCTGTCCCAAGGAA
GTGTACGACATTATGCTGGGGTGCTGGCAGAGGGAACCAC
AACAGAGGTTAAACATCAAAGACATCCAGAAAATTCTTTT
TGCCTTGGGCAAAGCCACACCTGTCTACCTGGATATCCTG
GGCTAGTGTTTGTTGGGAATATGTGTGGATGTCTGTCTGT
CTGCGTCCGTCCAACAGAGGAACGAACAACATGGGATTAA
CCCAAAACTACATGTACCTTACTGCGCCACTGTCAGACAC
CTACAACATGGGGATGGACTTAAGTGCCTGCTACTCCTTT
CGATACACTGGATAACAGTCTTTAAAAGCACTTTTACATT
TTGTTTACCTGCATATAAAGATGTACAGTTCTACTGCAAG
ACGAGGAGTGTCCTTTCATGATTTGATTTCCTTTCGTCTT
TTTCGTTTGGTAACAGCAGCCTACTTTTAAACTCCAAAAA
AGGAATAACGGAACCATCTGCTCCCTCTCTAAAAATGGAA
AATGGAAAAAAAACTAAAGTGGAGGAGGTTCCTGACTGCT
TGACAACTCTCTGTGTTATTACTTGCTTTTCATTTTATAA
ATATATATATATTTTTATTTATTTTTCTTTCTCCGAGTGT
GGATGTATGTCATTTTTCTTGCTAAGGGTGTGTTGCCTTT
CGGATATGACTGCTTAGTCAGATGATTGGCAAGGACTTTT
TTTAAAAAAAAAAAGCCTTACTGTGCTCTGATTGGCCGGA
TCTTCTCTTTTGACTATACAGGAAGTATCCAACAGGGCTT
TTAAACATCCGGAGGAGCTTTTTAGCGAATGGATTCACTC
GAAGGAACCAACAATCAATACAAAGGAGTTTATTTAACAA
AAAAAACAAAAAAAAAGAATGTATATAATGTAAATTTCTG
TGTCACAAGAGACAGTATGTTAACTTATTTTATTTCCTGA
TTAGATGATTTTAGTTTCTTGGTGTGCTATTACGGTGGGT
GAATTCTATAAATATTTTGATCACATTTTAATGTTTTTTT
TTTTTTCTTCACACGCCCATAGAATGTACTTTCCTAATGA
TTTCCCCCTACCTACTTTATTTTTTTTTGTTTGTTTGTTT
GTTTGTTTTGGGTGCAACCAAGAGGTAGAGAGCGGGTTCA
TGAAATGTTGCCTCTCTCCTTGTATTCCAGAGACCATTTG
CTTCTGAAATGAATGTAACAAGGAGGGTAGATTTATGTCA
GATGATGAGAAAATACTCATATTCCATTCATTAACTCTCA
TCGCTTTTACGAATTGTGATAACACTTCTTTGCAAACATT
ATACCATGCTTTCCTCAGAAGTGGTAGAACTAGCATGTAC
AAATTATTCTGCAACTCTACCACTTTCCTCTAGTAAATAT
TGTAGCCACTAATAGAGCCATCAAAGTATAACAGAGGAGA
CGCTCAAACAATGTTGTGGATTCTGTCAGGTGATATTCTT
CTTTTCTCCCCAATGTTAAATGACTGCAAAGACAATTTGT
ATATTTGAGATGAAGACTTCCTAAGACTAAAGGGCTTCTT
TGAAACATGCATCATTTATTCTGAAGTGACATTTGTATTT
TAGCGTTCTATAGCTCATGCAGTTTTGCTGGCTTATTCTT
TTCATTCAAAGTGATCTGTGGCTTAGTATTTGTCCTATGA
TAATTAAACCAAGTAAACTTTAGTTCGGCTTTAGAAGGAG
CAGTGCACCTATTGGTTAAAACGATTCTTGAGCATATATT
AAGTGACATTTTGGAACATCTTCCTGAATATATCCAAATC
CTGTATCAAAGGCATAACATACCATTTGTGGTCACATTTC
TCGCACACCCAAGGGCTCACGAATATCCCAAACAACCAAT
ACCGTAAATGATAACTGTCAAAAACTTTCCTGCTTTCTAT
CAGGACGCATGACTATAAATTGCTATTCGAAGCAAACTGC
CCATCACGGTTCCACAGAACACATTTGCGCTTAACCATAA
TCTCCCCTTTCGGATCAGGAAAAGTTCCTGCCGTAGAGGA
AGCAACTTGAACATTTGTTGATCTTGTTATGTTGTTTTTT
TCTCGCTGCTTCCCACAGTGGGCAGATAATTCTCTCCACA
TCTATGACAAGGGGGAAATTGCAAAAGTCTTTCAATAACA
CCGCCAGCGATGTGCTTACGTGTGATAAGATGCTCCTTAT
TTTGATATTCTCGTCGGGTACAGGGCCCTGCTGCAGATAT
TTATTGACTTTACAATTTTGCCTAGCTTGTGCGCAAAGCT
TTCGTGTAGAAAAGTAACAGAAGAGATTACCCAAGTGTGG
GTGCCAGGATGCATGCTTGAAAGGTTTGTGGTTTATTAGG
TAAACAGACCTGCTCTTCTCTAGCACCTGCATCCCGGACG
AGCCCCCAGTTTGGAAATTTGTTTTAAAAACAGCAAGCCA
CTCTGATTTTACATGTCAAATGTAGTACACAGTGAGCATT
CACACTGAATTAGGTTTTTGAAAATGATTGCAGTCTTCCT
GCAGTGTCGGGAGAATTCAATTGTTACCAAAGTTGAATTC
AAATATAAAAATTATATGTTGACAAGAACATTATTGATTA
AATAGTCAATCCCTTTTCAGTGTGGGGAATTTTTTTCTTT
TAATCTTTCATGCCCACATGTTAGCTAGTATCGTTGGTTT
CATGGCAGAACCGCATTGTTCTCTTCTGAAGCAACATTTT
GCGATATATAAGCTATATGCCCTCATGTATTCTTTCTCAG
CATGTGTATTTATGTAACAAGTGAAAATATGAAACTGCAC
TTAGTTCCACTTAGTTGAGGACAAAAGGCTGCAGCTCACT
GTTGTAAATCGGTCGAGGTGGTGGTTACTGAGGATTATTT
GAGTCATTGGCTACATAACTGTGACTAACAGGGTTGAAAG
AGTCAAACACTTCTCTGCAGTTTACTCTGTGAGACCGATC
GTTGCTCAACGACCTGTGAAAGGTGGATTATACAAACGCA
GCAAGGAGGGGTCAGGCGGCGTTAGCTGCGGGGAGTGGGA
AGGCTGTATCTTTATCACTTCGAGCCGTCAGAGAACTGAA
TTAGTAGTTTCTGTAAATGAAAGGACGCAAGCATGTAAGC
CACAGCTGGTTTAGAGAGGGGGATCAGAAGAGAGAGTGTG
TGTGACAGCAGGGTGATGCTATGGCAGCTTCAGGGGTTGC
CGTGACTCTAATGACTTCACCTTGCAGAAATGGGTGGAAA
TTACCAATGAAATGAGTTTTTGGCCTGGGCTTTTAGATAT
CCCTTAAATATGATGGCCAGTCTTTCGGTAATCCCCCTGA
GGCAGCAAAGAGAGGTGTGTGCGGTTGTGCCGGTTTGTGT
GTGAGAAAGCGAGAGGTAGGCGAGATGAATCAGTGAAGGT
CACACACTAACATAGTGGATAGAAGTGCCACAGCGCTGTC
TGTTGGCAGGCTAACAGAGTTGAGTTAAGCATTCAGAGCT
GTGAGGCAAGCAGAATCTCCCTCTCTCACTTACCGCCACC
ATGGCAGCGAACAGGCGCGGGGCGATTGATGAGAGGTTTA
AGACCTTAATCATCAGGAGAAGAAGCGAGGCAGGAAGCTG
GAACATTACGTCTGGAATGAGCTCTCTTTCAGCACTTCAT
AACCCTGCAGAAGGGCTGCAGAAACCTCGACACTATCACG
CTTCACTGCTGATCTCAGATCAGCTCTCTCCTTATCCATT
TATCCTACCTTCTGTGGCTCCGATTTACCAAAGCATTTAG
TGCATGCAAGACTGCCTTAGTGAGGCAAACTGAAGACGTA
AAACTTTAATTGCCCAATCAATGGCAGAATTTCTAAAATC
AAATACAGGCAACATGTTTTAAGACGTCATGTGTTCACTT
TTTTAGCTGAATTACTGCCTTTGATATATTCCTTTCCAAG
TACTCCTGCGCAAATACTAATCCGCGAGTAGCTTCTTTCT
AAACCAGTAACAACCCCATTAAATTAGCCAAGCAGCTTTT
AGAACTCATTTAACACACCCAACACATGATGTGGCCACCT
GGAGCATTAATCTCCAAGAGATGCAGTCACGCTGAATATC
TAACTGATTGAATCTGTTATCCCAAATCGTTGTTGCTGCA
GATCTTCAGCTGTCATTGTGGCACACATAAAACAAGCTAT
CCGGTTTTCGCCTGCAGGATAAAACTCATTTTCATTGCCT
TCAAAACATTTAATTAAAGATCAGTATCTGATTTGAAACC
CCACTTCTAAATTACAAATGAGACTACCAGAACAAGTCCT
TATCTACCTCCAGTGCATTGCCACTTAAGTACTCTTAATG
TAGTCTGCAAAGAAGTACTGCCAAACTTGCGGTTGATTCG
TGGCACACTATGCTGATGATACGAATAATTTTGTACATCC
GAAGCTGAGATGTCTTAGAAAGTATCAGCTGCATTTTGCG
AACCTGACTTAGCTCACGCTGTGCTTGCTGTTCACTCTGG
GCACACGGACAAGCATGTGAATCTTGTTACTTGGAACCTA
AAGTGATCTATAGTTTAAGCCAGAAGATCTCCTGAGCTGT
GGGAAAAGCTGAACCCTCTTCCAAGGACAGTTGTGCATTT
AACTCGGAAAGCCTGGCCAAATGCAACTCCCGAATTCTTT
TAAAAAGGAGGTTAAAATTGACTGCGGCATTAAGACTTCA
GATGGGGATGTCACCCCAGAGCAATCTCCTGCACTGTCAG
CAGACTTTGACATCTAGATTAACCTTGCTTCCGTGAGCGT
GCTGACGACTCTGATTGGGATGCAAGAAGCATCTCGGATC
TTCTATTCCAAAAGCACTTCGGCCCCCTCTTTCCCTGTGT
GAACAGGAAAGTGGGGAGCATGAGCCAGCACATACACAAA
ATATCCAAGGGAGGTCCTTATTTGTGTCCATGCTGGAGGG
GATGTTATCACTTTTGGAACGGAAATGTTGAACAAATGGC
GATCTATTCCAGTCTTGCCACCATTCCCTGAGTTTACCAG
TCGGCCAGCAAGCAAAAGACAAGCCAAAGGGTCTAGGTGG
ACATCTTATGCCTCTCTCTCTCTCAAGTCTTTTCCTACAG
AACATTTTATTTCCTAATAGAGACTACGGCCCTTTGTTCC
ACAGAAGAATACGTGTCAATCAGAACAAAAGGGGGAGTGA
GATCCTTTGAGCTTTTGCTCAGGCACTTAAATGTATTATT
CAACCTTGTTCCACTCTCTGGTCAAACTGTGGGAGAAAGT
TGTTTTACGAAGGTGATTACGACAAAGAAGTTCCGACTTT
CAGTGAGAAGTTATTACGCCTTAGTTTCTTTTTGTAGTTG
TGCCAGATAATGACTGTAACACTGTTGGTCAAAGCTTAGC
ATCAAAGCAGCTTGATGATTAATTGACACCTCATTTTGTC
ATCCAAGTTTGTAAAAATAACTGTCAGTTGTCAACTCAAG
TAGAAGCCAACAAGTACTTGTTTTTTCTTTCCAGCAGATA
TCTTTATAATATGCCTGTGTGCAAGTAACTCGCTCCTGAA
AAAAAAGTGTTGGCTTGCCCCAGCACTCCACATGTGAAGA
TGGCAGAAAAGTTGTAAATTGTAATTTTTAAGGCGCAACA
TAAAACAATGCCTGATTACCCTAACACAAAATGAACTAGA
GAAGATTTAGAGGCAAATGGTTAAGAGTATGGAGACACTC
TGGCTTTCTAACTGGAGGACCTACTGCTGAGAAACCACTT
AAATAGTCTTCATTAGCGGCACGGCTAACAGTAGAACACA
CCGGCAGTGTTAAGAAGGTGCTAGCAGGAACCCATACAAT
AACCTAACTAAAAATAACGCTGTGAGAAGGATGGATAGAG
CAGCAGTGGGGTGGTGAGCTTGTGACTCACTCCGTGCTGC
CTACGTTTGCCTCGGAGCTTGGGTGACATTTCAGATCACA
GCTCATCTGCACTTGTGCTGCCACCCACAACACCATACGT
TTAAATGAGGCTACTGCAAACTAGCCTCTGACTGCAGCGT
AACAAGAACATGTTTGAGTCACAGTTACAGTGCGACATCT
GGCCTTTCATTTTCAAGGAAATCTGTCATGATCAAGCTGA
CATTACGGTTCATGAAATGTTTAGCATATTCAGTATATGG
TCTGTTAAAGTCCACAGGAAATCAAAATGAAGTTTCTTTT
AGATGTTAACATCAGTATGTTAGTCTTAAGGATATCTATA
CATTCCAGAAACAGACAAAATTTACATTAAGAAGATGTAA
ATATCCAAAGATTGCAGTTTGTCACTTCCGCATATGTGGT
ACGGTACAGTAAGGTATGGTTTGGTGCGCTTTTATGCCTG
TTTCCACTATCAAAAGGTACCAAAAAGCGAACCCTGCCAT
ACAACTTTTTTTGTACCTTTTCGAAAGGGTACGTAGCACA
ACAAAGCAGCTGTACGCTATTGGTTTAGAGAGATATGTGC
AAAAGCCAGGAGAATGAAAACATGGAAGTACCATTTTTAA
ATACACAAGCAAGAGATTACATCATAATAATATATACATA
TAATAACGAGTCATGGTCAACCCGAGCTTAAACAAACCTT
TTCGTCGTCTTGATGAACAGCCACAAAGGCAAGTAGAAGA
GAAGTATCTACCCTGTTCCCTGTTGTTATTTACAACGATT
TTTTGATGTCATCTCATACTACAGTATCTTTTGACCAATC
AAAGGCTCTATAGTATGCCCCACCCCCTTTAAGATGCTTG
TTTGCTTTTTTTATTTGATACACTCGAGTTTAACCACTCT
CAGTGGCAGAGTTGTGTGAAAAAATAAACTCTATTGGCTG
TTTTTCTTTCATTAAAGGGAGGAGGTACTCTATGTCCCGC
CTTCAAGTTTCAGTTGAAATTACATCACACATCGAACAAA
AATAACCTTTTCAAAGTGCTTCATGGGACCTTTGATGCAT
TTTATAAGGTCGTGACAAAACAGAAAGAGGAAAATGGTGA
GATCTGGTTCAGTGTGTTCTTTTACTGGTGCACCCAATGC
TAACATGATCATGCAAGTGTTGTTTATTACTGCAGTCCAT
GGAGACTAACATTTCAGGCCATTGCTTTCACAGAGGGTTT
GATGGCTGAGCGACAGCATGAGAAAAGAAGGTCAGAAATA
ATAAATTGGCCTTAAGTCACAGAAGCAGCAATGTAGGACA
CATATGCTTTATTAGGCAGCGGAGTAACAATCATTTTTCA
CGCACAGGGATGTTTTAGAGATTAAATGCTTTTAGAAAAT
AGATTTTCTTTTGTACAGTGTGTTGAAGAGTTGGTTTCAG
GGCAGCTCTGTTGATAAAAGTGGGAAAGTATGCTCATTAA
ATAATTAGCAAAAAATAATAGGTCTCATTTCTGACACAAT
GTTCATATTATACTTGCTGCAAACCATTTGCTTTCTGAGT
GATGGCTCTTTTGGACTTGCTAGGGTGATATATGTTAGCA
GTATATATTTTGCTTTTTGTATGTGTTGATCAGGCTTGAT
TTAAAATTGTTCTTTGGTGGCTTTTGGTGAAATAGTGACC
AAAAAGCTGTTAGTTATAGTATGATCTTCCTCTAACAAGG
ACACTCAGGCTTATTATTAATAATTTCTTCTCTTTTACTT
CTCTCTCTCTTTTTTTTTTTTTTTTTTTGTAGAATTGATC
CTAATATGAAAATATAATGATATAGCAGTGTCATATTTGA
TAATGTAAGGCATAATAACCTTCTTTGAACAATTCATATA
CACATCAGTCACTGGAGATAAGGCAGCGTTTGAATTTTAA
GCTACTATTTTTTTCTAAATTTGGGGAAGCCTTCAAAGAT
TGGTGATTAATGAATGGCAATTTAGATAAGATTATTTCCT
AGATCTTTTGTGAAATGTTCTTTTTTTTTGTTAATACATT
CAGACTGAACTTCCCTTTTTTGCGTTATGTTATAAATCTT
GTGATGAAAGCCATAGATAGATAGTCTATTTGGTATTTAA
AGCCATATAAGGAAGTGTGTTAGGAATCACATTAGGAGCA
TATGCACACTGGGAGTGTTTTACTGTATATGACAACTAAA
ATAGGACAAACATTATGCATATTTCGCCATTTATTTACTA
ATAAAAAACTATTTGGGAAGCCTGAAAAAAACTTTTCAAA
TGTATATTTATATGTAAACTTCTAATATCATGACAACCAA
AACAGCAATGGTTGGCTACAGGGCCGTAAGAGTACATGAT
CAAAGTGTTTCTTTACAAAGTAAAGCCTGGCATGCATAAT
ACAGCGTCTTTTGTTGTTATCATGACAAAACTGGATATTT
GGTAAAGGTTTAGTACATGCATGTAGTGGCAAGGCTGATG
AATAATCATAACCATTCACCCAAAAGTTACGCTTTTTGTT
TTTATTATGAACATTTTTATTACAAATATTAAAAGTGACA
ACATTTATTCACCCTACACTTCTTTACACGTCTTTTTTTC
TGCTGCATACAACAAAATATATCAAGAAGATTGTTGGTAA
CAAGTGTTTTGTCTTCCAACAAAGAATTGAGTTTCCTCTG
TCAACTGTTTCTTTTTGCGTTCAACATAAGAAAGAAGCTC
ATAAAGGCTTAGAGCAACTTGAGAGTGACTAGATGAACAA
AGTTTCATTTTTATAGTGAACTCAGTGCTTAATTTGAGAA
AACATTGTATTTTTGAGTTTTTTTTTTAACCCTATACATG
CATTCCGCATCACTAGCTGTGTTTCCATCCACCTGTTTTC
ATGCACATTTTGGAGATGTGCATAAAAAAAATGGTTGATG
GAAATGCCAAGATGTACATCAATTTTAAAAATGTGCATAA
AATATGGTTGATGGAAAAGAAAAATGCGCATCAATATTGA
AAATGCACATATGCGTTTTATAACCGAGTAGGAAAATTTT
TATTTGATAAGAAAAGATGTGTATAAGCAACAATGGAAAC
ACTTTTACCGAACAAATTCCAGTATGCGCATTAAAAAAGG
TCATGTGATTTACATATAAGAGATCATGTGATGTTCAAAA
TGTGTGTGAATGGACAAACCAGCAGGCTGAGCAGATTGTA
AAACATCTGAAATGTTGTTTGGTCCTTCTAAAACACCGTA
ACCATTTCAGTATTAGTGTTATTACATTATTAATTACCTC
CAGAACTGTCAATAGCGTCTGCGCTTTGCGTCTCATGGCT
TCAAATGCCCTTTCTGGGTCATTTTTTAAATAAAGAAACG
ATTCACGCAGCTTCTCCTACTGCAGTAAATTTAACTTTTA
CTGTCGATATTTGGTGCCAGTTATTCAGGAAGTGACTAAT
TTGTTCTCTTTGACTCGTTGCTGCTTTATTTGCATATCTT
TTATGCAATATTCCTGTTTTGCGCATAAATTTAATTAGCA
TTTTTGGATGGAAACATTAGTGCAGTGATTCGCTTCTGAT
TGCACTATTTTTGTATGTAATTAATTATCAGATGCGCTGT
CACCATTTAGTGACCACATTTTGTGAAAACTTAAAGTGAG
CAGTTGTCGACGTTTAAATCGGCTTTTATTTGCTAGTTTT
GCTGTATTGCGGAAACTATTCAAGTACAAATTAAACACTG
GGTGATCTATATGCTTAAATTCTGTTGTGTCTAACCTCTT
AGCTTTATTATATGTCAATCAGGGAAGACAGAATGGAAGA
ATCATGTAAGGTCTGCTATAGAAGCAAGCGAAATGTTGTC
CCCTCTTACAATCTCAGTGTTAAATCCAAACCCAAAAAAA
GCCACAGCTGGAACTGACATTTCCAACCTCATTTTTAAAA
GCTGACCTCAGCTATATTAAAGTCTGCAGGCAACAGGATT
CTCAACCCAACATTATGGCTCGCCGTGTATTGTTTAGTCC
ATCTTTTCATCTCTCAAACATCCTGGCCCTCCAGCTAGCG
GACATACACTTGAAAACTAGACCTCAGAAAAAAAAAAAAA
AACAGGGATCTGGAATGCAGGGAGAGGAGATAGAAATCCT
GATCATGTATGTTTCCAGTAACCCATCACGACGTTGATAG
ATATCAGCGGAAGAGAAATATATTACAAAGGAAGCTGTAT
CTCAGCCTCCTCAAATCCATTTCCACAACTTCAGTTTAGT
TTAAAAGCTTGCTCATTGACGCATTTGGTATTGATGTCAT
TAGCCCGTGTGTACATTGAGCGATTCATAAAACTGTGCTA
AAAAGAAACTCATATTATCAAAGCGTGTGTGTGTGTCACT
ATCATTATAGTATTCATCATTCAACCTAATATATTTCTCT
TCCTGTGAACTGTGTGTGGGGAAAACAAATCTGTTGCAAT
ATTAAACTGTGGGGGACATCTAAGCTACACATCTGTTTAT
ATACGTGGTCTTTTTCATCTGGGCTAATGCGAAGACAGCA
GTCGGGTTCAAACGTCTGAATATTTATGTGTGCAGATACT
TTGTGTTTCCATCGCCACCGAGCTGTGTACGGTTTGAAAA
ATAATAACTTTGTGACACCCCTCTGGCATCCGCAGTAATG
TATTTTCCATCGGAGAAGTCCTAGCTGAAGTGCTGACTTT
ACGATTTCTCTTGAATATTTCTATCATCTTGTCTGAACCC
TCGTTAGGATGATGAAGGAACGAGGTGTGGAAAAAAAATC
TCTCACGGTTCCTCTATTTGTAACTCATTGTTAATCCACC
TGTGTTCCGTTTACTGATCCATCTATAAACTAAAAACAGC
TGTAACTAAACTATGTATCCTATGATGATTTATGTAGACT
TATTCTATAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations