header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-101
Transcript Name: lars2-202
Previous Names: lars2-001, dkey-288i20.5-001, zgc:165522-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047873 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047873|OTTDARG00000033944|ZDB-GENE-070928-3 lars2|OTTDARP00000037575 DKEY-288I20.5-001 LG_ CU467885.10 Danio rerio protein_coding KNOWN, 890 bp
AAATAAAGTTCAAGCTGTTTGAACAACATGGCGGCGCCCA
TGTAGCGGTGTGAATCTGTCAAAGTACATCGCAAAAATTA
AGTTTTAAATGGAGGAACAAAATCAATAACGCCAAAGAAA
AGCTAAATATACTCCCAAAGCTCCAGATGGCTGGTCTATG
GTATTTGCGTCCTGGAGTGATGGCCGTGTGGAGGCCTGCT
GTGTGTTTGTGGGGGCCGGGTCGGTCTAATCCTGTGATCC
GAGTCAGCGTCTGCAGTCTGTTCAGTGAATCAGGTGTGTG
GGAAAAAGAGTACAAGGCCGAGACGCGCCGTCGAGTGGAG
CAGTGGTGGCACGGACGCATACAGGAGCAGTGGCGGACAG
ACGCGGAGGATCAGAGCTCCCGGAAGAAATTCTACGTCCT
CTCCATGTTCCCATACCCATCTGGCCGACTGCATATGGGC
CACGTGAGGGTTTACGCCATTAGCGACACCATCAGCCACT
TCCAGAAGATGAGAGGCCATCAGGTGTTGAACCCGATGGG
CTGGGATGCATTTGGTCTGCCGGCTGAAAACGCTGCCATC
GAGCGAAATCTGGACCCGGAGGACTGGACCAGAAGTAACA
TCGAGTCCATGCGGACGCAGCTGGACAGTCTGGGCCTCTG
CTTTAACTGGGATCGGGAGATCACCACGTGTCTGCCGGAT
TATTATAAGTGGACTCAGTATCTGTTTATCAAGATGTTTG
AGGCTGGACTGGCCTATCAGAAAGAGGCTCTGGTGAATTG
GGATCCGGTGGATCAGACGGTGCTTGCGGATGAACAGGTG
GATGAAAACGGCTGCTCGTGGAGATCTGGAGCTCCTGTGG
AACAGAAGATGCTCAAGCAGTGGTTCATCAAAACCACCAA
CTATGCCAAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lars2-202 Contained in:

OTHER lars2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047873 (1)
  • Ensembl_Trans:ENSDART00000149675 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC151831 (1) 3032 bp
    CITATIONS (2)