header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-110325-1007
Transcript Name: tgfb2-201
Previous Name: tgfb2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047868 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047868|OTTDARG00000033939|ZDB-GENE-030723-3 tgfb2|OTTDARP00000037570 tgfb2-001 LG_none CU929110.10,CU467885.10 Danio rerio protein_coding KNOWN, 1242 bp
ACAAACATGAACTTGTACGTCTTGAGCCTCCTTCTGCTTT
TGGATTTAGCCGCGGTGGCCGTCAGTCTATCCACTTGCAG
CACTCTGGACATGGACCAGTTCAAGAAGAAGCGGATCGAG
GCTATCCGCGGCCAGATCCTGAGCAAACTGAAGCTGAGCA
GTCCTCCTGAGATCTACCCCGAGCCCGAGGAGGTGTCCCG
GGACATCATCGCCATCTATAACAGCACACGGGACCTGCTG
CAGGAGAAAGCCAACGAGCGCGCGGCCACATGCGAGAGGC
AGCGCAGCGAGGAGGAGTATTACGCCAAAGAAGTGCACAA
GATAGACATGCAGCCCTTTTACCCTTCAGAGAATGTCATC
TTATCACAACATTACTACCCATACTTCAGGAGGCTGATGT
TTGACGTGAGCTCCATGGAGAAGAACGCCTCAAACTTGGT
GAAGGCGGAGCTCAGGATTTTCAGGCTGCAAAACCCAAAG
GCCCGCGTTTCTGAGCAGCGCATCGAGCTTTACCAGGTTT
TAGGGCATAAAGACCTGACGTCACCTACACAGCGATACAT
CAACAGCAAAGTGGTTCGCACCCGGACGGAGGGAGAATGG
CTGTCGTTTGACGTGACGGAGGCTGTCAGCGAGTGGCTGC
TACACAGAGACAGAAACAAAGGATTCAAGATCAGCCTGCA
CTGTCCCTGCTGCACATTTGTGCCGTCAAATAATTACATC
ATCCCCAACAAGAGCGAGGAGCTGGAGACGCGCTTTGCAG
GTATAGACGACAGCTTTGTGAATGGAGGGGATCTGAAGAT
GTTTAAAAAGCGCCGCCACAGCGGTCAGTCTCCACATTTG
CTGCTGATGCTGCTGCCATCATACCGTCTGGAGTCGCAGC
ATAAGAGCCACAGACAGAAGCGAGCCCTGGATACTGCTTT
CTGCTCCAGGAATGTGCAGGACAACTGCTGTTTACGCTCG
CTCTACATCGACTTCAAGAAGGATCTGGGTTGGAGGTGGA
TCCATGAACCCAAAGGGTATAACGCCAACTTCTGTGCAGG
AGCCTGTCCGTATCTGTGGAGCGCAGACACCCAACACAGC
AATATCCTTGGCCTTTACAACACTATTAATCCAGAAGCAT
CTGCATCTCCCTGCTGCGTGTCTCAGGATCTGGAACCCCT
CACAATCCTCTACTACATCGGCAAGACCCCCAAAATCGAG
CAGCTCTCCAACATGATTGTCAAGTCTTGCAAGTGCAGCT
AG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tgfb2-201 Contained in:

OTHER tgfb2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047868 (1)
  • Ensembl_Trans:ENSDART00000148927 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY338730 (1) 1242 bp
    CITATIONS (2)