Transcript

si:dkey-33i11.1-002

ID
ZDB-TSCRIPT-100915-95
Name
si:dkey-33i11.1-002
Previous Names
  • ch73-124g13.2-002
  • ottdart00000044953
  • zfinnucl0000004678
  • si:dkey-33i11.1-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044953 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044953|OTTDARG00000032229|ZDB-GENE-030131-4630 si:dkey-33i11.1|no_translation CH73-124G13.2-002 LG_ FP016247.6 Danio rerio protein_coding NOVEL, 874 bp
TAAACCTGAGCTGAGGCTGTGGAGTTTGGACTACAGGGAC
TATGGGGAGTATTTCTGTGTGGCCCGAAACCCGCTCGGCA
CAGACCGGTCCAGACCTGTTCTGCTGAACCTCACCTACCC
GCCCAAAAACACAAGGATCCTCATCAGTCCTAAAGGAGAC
ATCATGGAAGGCTTTTCAGTCAATCTGACCTGCAGCAGCA
ACGCTAACCCTCCTGTGCTGAAATACGCCTGGTATAAAGT
GAACGGTGGGCAACCCTGGACTAAAGGCACGGCGCAAAAT
CTCACTTTCTTCAGTGTGCGTTCCCATCATGCCGGACAGT
ACTACTGCACTGCTTGGAACGCATTTGGCATGGGGACGTC
GCCTACTATTTCCCTTCCAGTGCTTTGTAAGTTTACACCT
ATTAGGGATCACAAATTAGCTCAAACTACACTGTAAAAAA
TGCAGGGTTCCACACCGTTCCTTCATGTTGTCTCATCACA
AATAGATTAAGTTAACTTAAAAAATTTTTACAAAATATTT
TACAAATAAGTGGATTGAACATAAAACAATTAAGTTGTCC
ATAAAGCAGCAAGTTTGAGTGTACACAGCAAAATATGGGG
ACCCAAAACAACTCTATGGGTGTTAATTTCAACACTTTGA
AAGTGTCTCATGGGGTCCACTCAAAACAGACTTAAATCAA
CACTTTCAAAAGGGTTGGCACATTGACACCAAAGTAAGGG
TTAATTTTAACTCTGGGCAGAGTTAAAAAATGTAACTATA
TTTAACACCACCTGGTGTAATATATTGTTATTTTATTCAA
CTTTCTTGAGTGTAAATATGGTAAAAAGGTCAAATAGACT
GTAAATTACAAAATAAAAAACATTTTATTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations