Transcript

si:dkey-33i11.1-201

ID
ZDB-TSCRIPT-100915-1123
Name
si:dkey-33i11.1-201
Previous Names
  • ch73-124g13.2-001
  • ottdart00000044952
  • zfinnucl0000004602
  • si:ch73-124g13.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044952 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044952|OTTDARG00000032229|ZDB-GENE-030131-4630 si:dkey-33i11.1|OTTDARP00000035556 CH73-124G13.2-001 LG_ FP016247.6 Danio rerio protein_coding NOVEL, 1891 bp
GAGTCGGGGCTAGTAAATGGCTGGTGTATTTCTCCAGGAC
GGACATCTGTGTTTGGGCTGGGACAACAGTAACGCTGCCG
TGCCGCTATGATTATCCGTCACCCTTCAGTTCCACGCGGG
TCATGTGGTTTCACATATCTGATGATGGTCGACGGGAAAT
CGCTTTCCACACTGACGCGGGTCTGTTGAGCCCTTCATAC
CGGGACAGGATCAAATACATTGGAGGCTACAAAAGATGCA
GCCTGCAGATCACTAATGTGAAGCTGAGCGATGCGGGAAT
GTACCATTTCAGATTCGAAACCGACAACCAGCAGGGAAGA
TGGACGTCTCCTGATGCTATTACGTTGTCCGTCACAGAGC
TTCAGGTTAACGTACATCCGCCCAGAATTGGTAACATGTT
TGCTGCCGGTGAGACGGTTTTCCTGAGTTGTGTGGCACGA
GGTTGTGCTGCTCCTGGAAAGAGTTTTGCCCTTTATCGAA
ATGGAGTAAACTTGGGTCAGTCCAGCAAACTGTCCGCCAT
CTATAACTTCAACAGTCAGCATGCTGGAACCTACACCTGT
CGCCCTTTACCCATTCAAAACGTCCAGTCCCCGGGGCTCA
CTCTGGCTCTGGGATATCCTCCTCGCTACACCGCGATTCA
GATCAGCCCTCGAGAGGCCGTCCGAGAGGGCGATTCGGTG
ACTCTGACCTGCAGCAGTGATGGAGCTCCGCCAGCAGAAA
GCTTTGCCTGGTTTAAAGAAGGAGAGAGTGGCAGTCTGCC
AGACAGCTTTAAACCTGAGCTGAGGCTGTGGAGTTTGGAC
TACAGGGACTATGGGGAGTATTTCTGTGTGGCCCGAAACC
CGCTCGGCACAGACCGGTCCAGACCTGTTCTGCTGAACCT
CACCTACCCGCCCAAAAACACAAGGATCCTCATCAGTCCT
AAAGGAGACATCATGGAAGGCTTTTCAGTCAATCTGACCT
GCAGCAGCAACGCTAACCCTCCTGTGCTGAAATACGCCTG
GTATAAAGTGAACGGTGGGCAACCCTGGACTAAAGGCACG
GCGCAAAATCTCACTTTCTTCAGTGTGCGTTCCCATCATG
CCGGACAGTACTACTGCACTGCTTGGAACGCATTTGGCAT
GGGGACGTCGCCTACTATTTCCCTTCCAGTGCTTTATGCC
CCTAAAAACACCTCTGTTTTGGCTCAGCCCTCCACTGTGA
TCGAAGCGGGCAGCTCGCTGACACTGACCTGCATCAGTCA
GGCCAATCCGGCGGTGGAGAACTACACCTGGCACCGGATC
AATACGGCTGACGCCTGGGAAACTCGATCGGGCCCCAGCT
ACACCATTGCTGAGGTCAGTTCTGGAGCCAGCGGACAGTA
CTACTGCGAGGCCCGCAACCGCATCGGTGCACACAGCTCC
CCCATACTCACCGTCAAGTGTTCACCAGTGGTTGATTTAC
CAGTGGATCACACTTCATTTAGTGAATCGACTTCACAGAC
GTTTCTCCTCAAGGGCACAAAAATGTCTGACATCCCGGAG
GAGCCAGAGGAGGTGTATGAAAGTAGCCATCCATCCATCG
TGCCCTTGAAAGATGCAGCTCCGAGCTCTGAGGAACAGGG
AAAAATCAACTACATTACGGTGCATTATTCTCGCATGCCC
AGTCGGGACCAAGTGGAGGTCACAAACATACCGCTAGATG
GAGGGAAGAAGCTCAAAGATGGCGCTAATGTAGTTTATTC
TGTTCTTGCCATGCAGTCAAGAGAGGGAATGGAGGAGTCT
GGAATCTGAAGGTCGATTAGTGAAACCAATCAAAATTGTG
AAAATACTGTACACAGGGATTTTTGTTTACTACTAGAGCA
TGGATGTAAGAGACTTGAGAACCACACAAATAAAAGAAAT
TTGGTGGCCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations