Transcript

psmb6-202

ID
ZDB-TSCRIPT-100915-943
Name
psmb6-202
Previous Names
  • psmb6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047059 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047059|OTTDARG00000032746|ZDB-GENE-990415-216 psmb6|OTTDARP00000037028 psmb6-002 LG_none CU896563.7,CU929143.18 Danio rerio protein_coding KNOWN, 459 bp
GAGTAGTTCATGCAAGATGGCCGCGACGTTGCAGTTTCCA
GCTATGGCTTCAACTTTAAATAATTATAATGATTTATGTC
CGGATTGGACGCAGAGAGAAGTCAGCACAGGGGTGTACAC
GGTGCCAGTGGGAGGGATGTTGACCAGGCAGCCGGTGTCG
GTCGGTGGATCCGGCAGCAGCTACATCTATGGATATGTGG
ATTCAAACTACAGAAGCGGAATGAGCAAAGAAGAGTGTCT
GAAATTCACTGCAGGAGCTCTGACTCTGGCCATGGAGCGG
GACGGCTCCAGCGGTGGAGTGGTCCGACTGGCGGTGATCT
CTGAACAGGGGGTGGAGAGGCAGGCCATCCTCGGGAACCA
GTTACCACAGTTCTCCACCGTCTGAATCTTTACTGTCCAA
ACTCATAACCTGACCACGTTTGTCATACACCGTTTCAATA
AACCTGACTTCAGTCTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations