Transcript

pdp1-201

ID
ZDB-TSCRIPT-100915-876
Name
pdp1-201
Previous Names
  • pdp1-001
  • dkey-185p4.1-001
  • zgc:174908-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046825 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046825|OTTDARG00000033320|ZDB-GENE-060810-70 pdp1|OTTDARP00000036881 pdp1-001 LG_none BX511010.5,CR391916.5 Danio rerio protein_coding KNOWN, 2072 bp
AGGCTCTAGAGATGCAGGCGGGGTGTTAGTGTGTATGAAC
TCATGTAGTCTGATCAAACACTGACCACAAACTCAGTCGC
CCACTGATATCCTCAGGTCCTTCGAGGGTAAAGTCAAATT
ATTATGGCTGCTACCTCCCAGGTTTTCAGGGTCATCCATG
GCAGGAGATTTGGTCAGATCTTTGTGCCAGCCATAACATG
CCAAATCTGCATTCAGACTCCTCATCCCTGTTCCAGTGCA
GCTCAGACACACATCTCTGATCAAAGATGGCGGTTCCAGT
CACGGGGATACAGGACCTCACCTGCAAGGCACACCTACTA
CCTGACTCCACCTCAGGTTAACAGCATCCTAAAGGCTAAT
GAGTACAACTTCAAAGTTCCTGAGTTTGATGGCAAGAACC
TCAGCTCGGTCATGGGTTTTGACAGTAATCAGCTGCCAGC
AAACGCACCCATTGAGGATCGGCGAAGTGCAGCAACGTGC
CTCCAAACACGTGGAATGCTTTATGGCGTATTTGATGGCC
ACGCCGGCTGTGCTTGTGCTCAGGCACTCAGCGAGCGGCT
CTTCTATTATATCGCGGTTTCATTGCTCCCACATGAGACA
TTGATCGAGCTTGAGAACGCAGTGGAGAACGGAAGACCTC
TTCACCCCATTCTACAATGGCACAAGCATCCCAACGACTA
CTTCAGCAAAGAAGCCTCACGCCTTTACTTCTCCAGCCTG
CGCACTTACTGGCAGGAGCTCCTGGATCTGAGCGTTCCTG
GGGAGCAACCTGAGGTTGCGGAAGCTCTTGTGACTGCCTT
TAAAAGGTTGGACAATGACATCTCCCTGGAAGCACAAGTT
GGTGACCCAAATGCGTTCTTGCACTACTGGGTGCTTCGTG
TGGCATTCTCAGGCGCTACGGCATGTGTTGCACACATTGA
TGGTAACGAGCTCCATGTTGCCAACACTGGAGATGGACGT
GCAGTCCTGGGTGTTCAAGAACCCGATGGCTCTTTTTCTG
CTCTCACGCTCACCAATGACCACAATGCGCAGAATGAATC
TGAGGTTCAGCGTGTACGGTCAGAGCACCCGCACTCTGAG
GCCAAAACTGTTGTGAAGCAGGATCGGCTGTTAGGGTTAC
TCATGCCATTTCGAGCCTTTGGAGATGTTAAATTCAAGTG
GAGCATCGAGCTGCAGCGACGTGTTCTGGAGTCGGGACCG
GATCAGCTCCATGAGAATGAGCACGCCAAGTTTATCCCAC
CCAACTACCACACGCCACCCTACCTTACAGCAGAGCCTGA
GGTTACTCGACACCGCCTTCGTCCTCAGGATCGTTTTCTG
GTGCTGGGCTCGGACGGGCTGTGGGAAACACTGCACAGGC
AGGAGGTGGTGAGGATTGTGGGGGAGCATCTCACCGGGGT
GCACCAGCAGCTGCCGGTCAGTGTTGGTGGTTTTAAGGTG
ACCCTGGGTCAGATGCAGGGATTGTTGCAGGAGAGAAAGG
CTCGCATCTCCTCCACCTTTGAGGACCAAAATGCAGCTAC
ACATTTGATTAGGCATGCGGTGGGGAGTAATGAGTTTGGA
ATGGTGGACCATGAGAGACTGTCAAAGATGTTAAGTTTGC
CAGAGGAATTAGCTCGCATGTATAGGGATGATATCACAAT
TATTATAGTACAGTTTAATCCACACGTCATTGGGGGACAG
TAGAACAGGACAGATTGTTCCTCCCACACGCTCTCTGTTA
CATATATCTTCACTTTTAATCTAACGCACAATCTCGACGC
TGCATTATCCACAATATCAGCACAGCAAAACGTTACCTTT
TACCAGTGGAATGTATTACTCTTTTATGCTCACTTTTATA
TTCATGGCAGCTGCCTCAAAGGGGAATCATATCTCAGCTG
TGAGCTGTGTTGGATCCTAATGTTATATGTGGAATGAAGC
TAAACAGAAAAGGTCATGCTGAGCCCACTACAGAACCGCT
TTCACAATTGGTCAAATTGCACCACCAAACCATAAATCAA
GATTGGAACTCCTGGTGACATTGACTAATGTAGGTTCAGC
TAATTTTGCACTGAGGAGAGATTTGTATAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations