header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-876
Transcript Name: pdp1-201
Previous Names: pdp1-001, dkey-185p4.1-001, zgc:174908-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046825 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046825|OTTDARG00000033320|ZDB-GENE-060810-70 pdp1|OTTDARP00000036881 pdp1-001 LG_none BX511010.5,CR391916.5 Danio rerio protein_coding KNOWN, 2072 bp
AGGCTCTAGAGATGCAGGCGGGGTGTTAGTGTGTATGAAC
TCATGTAGTCTGATCAAACACTGACCACAAACTCAGTCGC
CCACTGATATCCTCAGGTCCTTCGAGGGTAAAGTCAAATT
ATTATGGCTGCTACCTCCCAGGTTTTCAGGGTCATCCATG
GCAGGAGATTTGGTCAGATCTTTGTGCCAGCCATAACATG
CCAAATCTGCATTCAGACTCCTCATCCCTGTTCCAGTGCA
GCTCAGACACACATCTCTGATCAAAGATGGCGGTTCCAGT
CACGGGGATACAGGACCTCACCTGCAAGGCACACCTACTA
CCTGACTCCACCTCAGGTTAACAGCATCCTAAAGGCTAAT
GAGTACAACTTCAAAGTTCCTGAGTTTGATGGCAAGAACC
TCAGCTCGGTCATGGGTTTTGACAGTAATCAGCTGCCAGC
AAACGCACCCATTGAGGATCGGCGAAGTGCAGCAACGTGC
CTCCAAACACGTGGAATGCTTTATGGCGTATTTGATGGCC
ACGCCGGCTGTGCTTGTGCTCAGGCACTCAGCGAGCGGCT
CTTCTATTATATCGCGGTTTCATTGCTCCCACATGAGACA
TTGATCGAGCTTGAGAACGCAGTGGAGAACGGAAGACCTC
TTCACCCCATTCTACAATGGCACAAGCATCCCAACGACTA
CTTCAGCAAAGAAGCCTCACGCCTTTACTTCTCCAGCCTG
CGCACTTACTGGCAGGAGCTCCTGGATCTGAGCGTTCCTG
GGGAGCAACCTGAGGTTGCGGAAGCTCTTGTGACTGCCTT
TAAAAGGTTGGACAATGACATCTCCCTGGAAGCACAAGTT
GGTGACCCAAATGCGTTCTTGCACTACTGGGTGCTTCGTG
TGGCATTCTCAGGCGCTACGGCATGTGTTGCACACATTGA
TGGTAACGAGCTCCATGTTGCCAACACTGGAGATGGACGT
GCAGTCCTGGGTGTTCAAGAACCCGATGGCTCTTTTTCTG
CTCTCACGCTCACCAATGACCACAATGCGCAGAATGAATC
TGAGGTTCAGCGTGTACGGTCAGAGCACCCGCACTCTGAG
GCCAAAACTGTTGTGAAGCAGGATCGGCTGTTAGGGTTAC
TCATGCCATTTCGAGCCTTTGGAGATGTTAAATTCAAGTG
GAGCATCGAGCTGCAGCGACGTGTTCTGGAGTCGGGACCG
GATCAGCTCCATGAGAATGAGCACGCCAAGTTTATCCCAC
CCAACTACCACACGCCACCCTACCTTACAGCAGAGCCTGA
GGTTACTCGACACCGCCTTCGTCCTCAGGATCGTTTTCTG
GTGCTGGGCTCGGACGGGCTGTGGGAAACACTGCACAGGC
AGGAGGTGGTGAGGATTGTGGGGGAGCATCTCACCGGGGT
GCACCAGCAGCTGCCGGTCAGTGTTGGTGGTTTTAAGGTG
ACCCTGGGTCAGATGCAGGGATTGTTGCAGGAGAGAAAGG
CTCGCATCTCCTCCACCTTTGAGGACCAAAATGCAGCTAC
ACATTTGATTAGGCATGCGGTGGGGAGTAATGAGTTTGGA
ATGGTGGACCATGAGAGACTGTCAAAGATGTTAAGTTTGC
CAGAGGAATTAGCTCGCATGTATAGGGATGATATCACAAT
TATTATAGTACAGTTTAATCCACACGTCATTGGGGGACAG
TAGAACAGGACAGATTGTTCCTCCCACACGCTCTCTGTTA
CATATATCTTCACTTTTAATCTAACGCACAATCTCGACGC
TGCATTATCCACAATATCAGCACAGCAAAACGTTACCTTT
TACCAGTGGAATGTATTACTCTTTTATGCTCACTTTTATA
TTCATGGCAGCTGCCTCAAAGGGGAATCATATCTCAGCTG
TGAGCTGTGTTGGATCCTAATGTTATATGTGGAATGAAGC
TAAACAGAAAAGGTCATGCTGAGCCCACTACAGAACCGCT
TTCACAATTGGTCAAATTGCACCACCAAACCATAAATCAA
GATTGGAACTCCTGGTGACATTGACTAATGTAGGTTCAGC
TAATTTTGCACTGAGGAGAGATTTGTATAGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdp1-201 Contained in:
OTHER pdp1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046825 (1)
  • Ensembl_Trans:ENSDART00000111156 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC155791 (1) 2108bp
    GenBank:CN020173 (1) 904bp
    GenBank:CK692817 (1) 783bp
    CITATIONS (2)