header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-672
Transcript Name: notch2-201
Previous Name: notch2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046009 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046009|OTTDARG00000032864|ZDB-GENE-000329-4 notch2|OTTDARP00000036304 notch2-001 LG_none CT573380.7,FP016062.4 Danio rerio protein_coding KNOWN, 10095 bp
AGTGACTGGGACGAAAAGAAGAGAGAAGTTCAGAAAGTTT
GATCACAGCGCAGCTACGTGAAGAAAAAAACTTTCAAATG
AAGTCACTATACGGATTTATGTGGTCAAACGAGACACCCT
GACAGACAAAACACAGCTTCTCCACCGAGTATAATTCGTT
TTCCGCGATTTGAAGAGCTTTTTGAGATTCGTGACGCTTT
AACCTGACGGAGCTCAGCCTCGCGCTGGCGGCTCTATGTG
GATTTTACTCAAAATATGGGCCAATTACCCGGTGTCTCTT
CGGGCGGAGTCATCCTTCTCCTTATTTGCTTTCTCAAAAC
ATCATATGCTCTGCAGTGTATCGACCACGAGAAGCCCTGT
GTGAATGGTACCTGTGTCATCTCAAGCAACGGGACACACT
ACTGCAGGTGTGCTCCTGGTTTCTTAGGGGAGTACTGTCA
TCACAGTGACCCTTGTAATCTGTTGTATTGTAAAAATGGA
GGAGAGTGCAAGGTGAGCGTGGCCGGTGTCCCTGGGAGCC
CCTCATGCGTGTGTCCTCTGGGCTTTGCGGGTGAGCACTG
CGAAATCCAGAAAAACTCCACCTGCTACCCCAATAACCCT
TGCACCAATGGAGGAAAGTGCTTGCTCCTTCCCAACGACC
AATACAAATGCCAGTGTGCCCTTGGGTGGACAGGTCAGCA
TTGTGAGCAAGAGGACGCATGTCTGTCCAGCCCATGTGCC
AACAAGGGTATATGCAATGCTCTGCCAAATCGCGAATACT
CTTGTACCTGTGCGCCTGGTTTTCATGGTTCCCGTTGTCT
TAACGACACAGACGAGTGTGTGGACCCGTTAGTATGTAAG
AACAAAGGCGTTTGTGTGAACACCATAGGCTCATATCGAT
GCAACTGCCAACCTGGCTTCACCGGATTGGACTGCGGGAG
TCCTTACTTCCCCTGCTCTCCGTCCCCCTGCCAAAATGGT
GGGACCTGCCGGCAAACAACAGAAACCACCTATGTATGCC
ACTGCCTGCCAGGTTTTAATGGTACAAACTGTGAGGTGAA
CATTGATGACTGTCCAGATCACCGCTGTCAGAATGGAGCC
ACATGCATGGATGGAGTGAACACCTACAACTGCCAGTGCC
CACCTGAATGGACAGGTCAGTTTTGCACTGATGATGTGGA
TGAATGCAGACTGCAGCCCAACGCCTGTCAGAACGGAGGC
ACATGCAGTAACACACGCAACGGCTACAACTGTGTGTGTG
TGAACGGCTGGAGCGGCCTGGACTGCTCTGAAAACATTGA
TGACTGTGCAGCTGAGCCCTGCACCGCTGGCTCCACTTGC
ATCGACCGTGTGGCTTCCTTCGTTTGCAGCTGCCCTCCCG
GCAAGACTGGTTTGCTGTGTCACATTGATGATGCCTGCAT
CAGTAACCCTTGCAAGATGGGCGCTCATTGCGACACAAAC
CCTGTCAATGGCAAATTTAGCTGTAACTGCCCTTCAGGAT
ACAAGGGCAGCACATGTGCAGAGGATATCGACGAGTGTGT
CATTGGGCCAAACCCATGTGAGCATGGAGGCTCATGTAAG
AACACAGAGGGGTCCTTCACTTGTAACTGCGCTCCAGGTT
ACACCGGCCCACGTTGTGAGCAGGACATCAATGAATGTGG
CTCCAACCCCTGCCAGAATGATGCCACCTGCTTGGATCAG
ATAGGAGATTACACCTGTATCTGTATGCCAGGCTTTGATG
GAACACACTGTGAAAATGACATTAATGAGTGTCTCAGCTC
ACCTTGTCTTAATAACGGTAGATGTCTAGACCAGGTCAGC
CGATTCGTCTGCGAGTGTCCTCAGGGTTTCACTGGGGAAA
CGTGTCAAGTGGACATCGATGAGTGTGCCAGCACTCCGTG
CCATAATGGTGCCAAGTGTCTTGACCGTCCTAACGGTTAC
GAGTGTGAATGTGCTGAAGGTTTCACAGGGCCTTTGTGTA
TGGAAAACATCAACGACTGTGAACCCCAACCCTGTCATCA
TGGCAAATGTATAGATGGAATTGCTACCTTTCACTGCGAT
TGTCTCCCAGGTTATATGGGCCCCATCTGCAGCGAGCAGA
TACGTGAGTGCCAGAGTGATCCCTGCCAAAACGGAGGTCG
CTGTGTTGACATGGTTAACAGATACCAATGCAACTGCCAG
CCGGGTACCGCAGGTGAGAACTGTCAGATTAACTATGATG
ACTGTGCCAGTAATCCCTGCCAGCACGGGACCTGTGAGGA
TGGAATCAATGAGTACAAATGCGTGTGCGAACCTGGATAC
ACAGGGGAACGATGCGCTGATGAGATCAATGAGTGCAGTT
CAAACCCATGTCAGAGTGGGGGGACGTGTGAGGATAAAGT
GAATGGATTTAAGTGCAAGTGTCCAGTTGGGACTTATGGG
CCCCTGTGTCTCTCAGGGGCAGACCGTTGTATCCGCATGC
CCTGCCGGCATGGAGAGTGCATTGGGAAGCAGGAAGGGTA
TCTTTGTCAATGTGAGCCAGGCTGGGAGGGTACGAACTGT
GACCAAGAGAAGAACGAGTGTCTGTCCAACCCGTGTCAGA
ATGGTGGAACCTGTAATGACCGTCTGAATGATTATACCTG
CGTATGCGCCCGTGGGTTTGCAGGTTTCAACTGTGAGATC
AACATAAATGAATGTGAGTCAAACCCCTGCATGAATCAGG
GAACCTGTGTGGATGGAGTCAACAGCTACGTATGCCACTG
CAAACCACCTTACACAGGGAAACACTGTCTGGAGAAGTTG
ATCCCATGTGCCTCTCAGCCCTGTCAGAGACGAGGAGTCT
GTCAGCCATCGCTGGATTACACCAGCTACACCTGCAAATG
CCACAGCGGCTGGGAGGGAGCCCAATGCACAGAGGATAAA
GACGAGTGTAAGAAGAGCCCTTGTCAGAATGGTGCTCGCT
GTGTGAATATAGTTGGCAGCTACCGTTGCGAATGCCCGCC
TGGATACAGCGGGGACAACTGCCAGACCAACATCGATGAC
TGCAGCTCTAATCCATGCCGTAACGGGGGTACATGTGTTG
ATAAAGTGGGCCGGTACTTGTGCGAGTGCAGAGCTGGTTT
TTATGGCGAGCGCTGTGAGGAAGAGGTGGACGAGTGCGCC
AGCAACCCCTGCTGGAATGGAGGACACTGCACAGACTACG
TGAACAGCTACACATGCCAATGCCCGCCAGGCTATGACGG
CATCAATTGTGAACGTGATATCCCAGACTGCACTGAAACC
TCTTGTCTGAACAATGGGACTTGTGTGGATGGAATTAACC
ATTTTTCCTGCCGTTGTCGGCAAGGTTTTTCGGGCCAGTA
TTGCCAGTTTGAACTGAACGAGTGTGACTCTCATCCCTGT
AAAAACGGTGGCACCTGCATAGACGGTCTGGGGACTTTCC
ACTGCAACTGCCCACTAATGTACAATGGAAAAACCTGTGA
GTCAATGGTGAATTTGTGCAGTCAGATTAAGTGTCAGAAT
GGAGGTACTTGCATCCAGAAAGAAATCAATTGGAGATGCA
GCTGTCAGCCTGGCTGGACAGGCCTGTATTGTGACATCCC
CAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGGTGTG
GCGGAGAACATGGTCTGCAAGCACGCAGGTCATTGTAAGA
ACATAGGCAACACACATCAGTGCGAGTGTCAGAAGGGATA
TACGGGCAGTTACTGCGAGACTGAGATAGATGAATGTCTA
TCCAGCCCTTGCAGAAATGGAGGGACATGTGTGGACTACC
AGGGTGGATATGACTGCAAGTGTAAAGCAGGTTTTCAGGG
TGTGAACTGTGAATATAATGTTAACGAGTGCCAGTCAAAT
CCCTGTCGCAATGGAGGAACCTGCATAGATCTGATCAACC
ATTTCTCCTGCTCTTGCCCTCCTGGAACCAAAGGTTTGCA
GTGTGAAGTGGACGTGGATGAATGTGCCCCGGAATTTGGC
CCGCGCTGTAAGAATGGCGGCCAGTGTGTGGATGGTGTGG
GCCGGTACACCTGCAACTGCCCTCCTGGTTTCGCTGGAGA
GCATTGCGAGGGAGATGTGAACGAGTGTCGTTCTGGACCA
TGCTACTCACCTGGCACCATTGACTGCGTGCCACTTATCA
ACAGCTATCAATGCCGTTGCCGTCTCGGTTATACTGGTCA
ACGTTGTGAGTCAATGGTTGATCTGTGCCAGTCCAAGCCA
TGCCACAACAATGGTAGATGCACTACGAACTCCAGCTCTG
TACACGGATACATCTGTACATGCCCACCTGGTTTCTCTGG
CTTTAACTGTGGCAATTATGAGATGTTCCCATGTGCCAGT
TTACGCTGTCTGAATGGTGGACAGTGTGTGGAGATAAAGA
GCCGCCCTCAGTGCCACTGCCCAGTGGGTTTTACTGGAAC
ACACTGTGAGATGTTAACAAACCATTGCGTGTGTCAAAAT
GGTGGCACCTGCATGCCAGATGAGTCCAACAAGTTTAGCT
GCCGGTGTCCACCAGGGTTTAGCGGGGAGACCTGTCAGGA
GACTCCACCTTCTTGCCCTTATCCGGATTGCGAACAGCGG
GCTGGAGACAAAGTATGTGACCTGCGTTGTAAGAACCCGG
AGTGTGACTGGGATGGAAGTGACTGTACGCTCCACTGGGA
CAAACCCTGGAAGAACTGCAAAGCCTCAGTGTCCTGCCCA
GACTTATTTCATAACGGCCGCTGTGACCCAGAGTGCAACA
ATGCAGGCTGCCTATTCGACAGCTTTGAATGCGACAAACA
TTCATCGGTGGGAATTTGCAAATACGACAAATACTGTGCA
GATCATTACGCCAATGGTCATTGCAACCAGGGCTGCAACA
CGGAAGCATGTGGCTGGGATGGTCTGGACTGTGCCAGAGA
CACTCCTCCCAAGCTGGCAAACGGCACACTGGTGATTGTG
GTTCTGCTGCAACCCAAAGAGCTGCTGGCTGACCTTAAGG
GTTTCCTGCGTTCTCTGGGGACACTCCTGCACACCAACCT
GCAAGTGAAGCTAGATGAGCATAATAAACTTATGGTGTAC
CCATTCTATAGAAATGAGCAGAATGAAATTCAAAATGAAA
TTGCCGCTATGAAGCAACGTGGAAAACGCGAGCTGGAGAA
CGAGATTATCGGATCGAGGGTTCACCTGGAGATTGACAAT
CGGCTGTGTACTCAGAACTCAGACGAATGCATCTCCAGTG
CAGACCAGGCTGCAGCCTTTATAGCTGCTGAGTACCTGAA
GTCAGATCTGCCGTACCCTATCTACTCCATCACCACCAAG
CCACCTAAAGAAACTGGGTTTAATTTCCTGTACCTGGTTG
CTGTGGCTGCTGCCATCATCCTGCTCATTTTGGTGCTGGG
TGTTTTGGCTGCCAAGCGCAAACGCAAGCACGGCACTCTG
TGGCTTCCTGATGGCTTTCTGCCAAACAAAGAGAGCAAGC
GGAGGGAGCCAGTGGGACAGGATGACTTTGGCATGAAGAG
CATGCAGAAGCCACAGGATGGAGGATTATTGGATTGCAGT
TCGAACCATCACTGGTCAGAAGAAGATCATCTTCCTAAAA
AACCTAGAATGGAGGATAAGCCATTGCTTCCTGTTGGAGT
GGATGGAGTGGACAGGAGAGAGTGGACCCTGCAGCATCAT
AAAGCTGCTGACATCACACTCACCCCCCCTCAGGCAGACA
ACGACATGGAGAGTCTGGACGTCAATGTTAAAGGGCCAGA
TGGTTTCACTCCTCTCATGCTGGCATCTCTAAGAAATGGT
AGCAGCCCTGACTGTGGCAGCATGCTAGGAGAGGAGGAGG
AGGAAAGTGGTGCTGACGAGCCTGGCACAAACGTCATTAC
CGACTTAATTGGCCAGGGTGCGTCGCTCAATGCCCAGACT
GATCGCACCGGGGAGACTGCACTTCACCTCGCTGCACGAT
ACGCTCGAGCAGATGCTGCCAAGAGACTGCTGGACGCTGG
TGCTGATGCCAATGCTCATGATAACATGGGCCGTACACCT
CTTCATGCGGCCGTAGCAGCAGATGCTCAAGGAGTTTTCC
AGATTCTCATCCGGAACCGTGCCACTGATCTTGATGCCCG
TATGAATGACGGAACAACACCTCTCATCCTGTCAGCCAGA
CTGGCAGTGGAAGGCATGGTGGAGGAACTGGTGCACTGCC
ATGCAGACGTTAATGCTGTGGACGATCATGGCAAGTCAGC
TCTGCACTGGGCTGCTGCTGTGAATAATGTGGATGCCACT
TTGGTGCTGCTCAAAAATGGAGCCAACCGAGACATGCAGG
ACAACAAGGAGGAGACGCCGTTGTTTCTGGCGGCTAGAGA
AGGCAGCTTTGAGGCTGCTCAAATTCTGCTTGACCATTAC
TCAAACCGTGACATCACCGATCACCTGGACCGCCTGCCGC
GTGACACCGCACAAGAGCGAATGCATCATGACATTGTGCG
TCTGCTGGATGAGTACAACCTGGTGCACAGCCCACACTCC
GGGCCCAACCATGTAGGAAATGGTGGAGGGCACTCATCGA
TGGTCTGTGGCACAAACGGGACAGGATACATCCTCGGCAT
GCGTCCTGGACCACAGGGCAAAAAGAACCGCAGAGCTGGA
GGAAAAGCAAATGGTGTAGCAGCCGGGACAGCCAAAGATC
TGAAAGAAATGAAAGCCAAGAGACGGAAGAAACCAACCGG
AGGAGAGGGGCCAAGTGTGGTGCCGGTGACCACAGCTGGA
GGGAATGTAAGCAGAGCAGCTGGTGGTCTCTCCGAGAGCT
CAGTTACCATGTCTCCTGTGGATTCCCTAGAGTCTCCACA
CTCATATGCCGGAGAGCCCGTGGCCACCTCCAGCACGGCC
AATTCTCCACCTCTGCTTAGCAGCCAGTCAGCGAGGCCCA
TGCTGCCCCCGGTGAGTCACATGCTGGGCCAGCAGCAAAG
CTGGGTGGGTTTGTCTAAACACAGCTACAATGGCCACATG
TTTAGCCTCATGCCACACCACCAAATGAGTGCAGGCCATA
GTGGCATGCAGCAGCACCACAGCCCAGGCATGTCCGCCCC
AATGAACGTCACCATGAGCCGTGAACAACTCCCGCCAATT
GTCACCTTCCAGATGATGCCGACCGGCAGCGGGCAGAGCC
TCCTCAAGCAGCCACAACAGGGGCAGATGCAGGCCCAAGG
GCAAAATCAGCCACAGGCTCAGCATCTACACTGCAGCCAG
GGTATGATGTACCCCATTCCTGACGTGAGCATGCAGCACA
GCCTATCTCACGCCCTTCAGCACCCTTCTCATGCTCACAA
CCACACACTCCAGCATGGGCTGCCTGATGGCCAAGCACGG
CAGGTGGTGTCCTATCAGCCACGTCAGAGCCCTGTGGATA
AGTACCCCACGCCACCTTCCCAGCACAGCTACGCCACTGC
CGGCTCTGAGGGAACCACCCCTGGACATCCAGCACAAAAA
CCCAGCGAACACCCCTACCTCACCCCTTCACCAGAGTCAC
CCGACCCCTGGTCCTCCTCGTCCCCACACTCCAACTCAGA
CTGGTCCGATGTCACCACAAGCCCCACACCTCTAGGAAAC
CCACACACAATGCCACCTTCCTGCCACACACACATTCCCG
AACAGGCCCAGCTGCAGCCCCCATCACAGGCCGCGCAGCC
AACACAGTCCCAGCAGTCCCAGCGCAGCAGTGTGTACGCA
TAAAAACTCAGACCTTTGAGAGTGTATTGATTCTCTCTCT
TCAGCAGCAAACCATCTTATCCTCCACTCTTTATGTCTTT
ATTACGCTCTGCATGTTGACTGTGAAGTTATTACATATTG
TAAATTCCCAACAGCCCCAATATTTTATTCCAAAGGACAA
AACCATTCGGGATTCCTGTTTACAGCCATCTGCGATCTGA
GGCAATGTTACCATTGAACGATCACACTGCCAAAAGTAAG
GAGTCTCATTTTGGGGGTACTGAAAATTTCAAATTTAAGT
CAAACCTTGAAGGAACTTTTAATATGTCATTTTTTTGTTG
GTGTTGAAGGCAAACATCATCAAGTTACAGGAATAGTTCA
CTCAAAAATTGAAATATTCTTTATTTAATCATTTTCAAAT
CATTCCAAACATGCATGACTTTCATCTGTGGGACTAAAAA
AACAAGACTCCATTAAGGTCTAGTGTATAATGAAAAGAAT
ATTTTCTTCAAAACATCCTCCACAGATGAAAAAAAAGTCA
TATTGTAAGTTTGAAAGCAGACGAAGATGCGTAAATAAAG
ATCTTTAATTTTGCGAGAACTAATCTTTGATTATTTAATT
CATCTTTTTTATGTATTGGGTCAGCTTTCATGTGTTTTGT
CCCAGCAAGCAGTTTTTGTTTTTAATAGATGTCTAATAGA
TGTCTAAACATAGTCGTCTTGGCTAAAACAAGGCTAAATT
TGGGCTGACAGTGAAAATCTAATAGACGTCAGAAAATAGA
CCCAATCTAGACTACACATGAATAGCTACACTTATCAAGT
CTTCCTAATCTGTCTATTTGACGACTAGTGTACACTCAAA
AAAAAAACTCGTTCAAACTACTTATTTAAAATGAGCTGAA
TCAACACAATTCTTGAGATTTCATTGGGACAACCTAATAT
TTTTATGTTCAATCCACATAAATTTGTTAAAAGTATTAGG
TTAACTTAATCAATTTGTGCTGGAACAACATAAAAGAATT
GTGAGGAACCCTGCATTTTTTACAGTGTAGTTTTGGGCTA
TTTTTAGATGTCTATTTTCACTGACAGCCCAAGTTCAGCC
AAGCTGTCTACGTTTAGATGTCTATTAGACGTCTATTAAT
CAAAATTGTTTGCTGGGGTTTTTTGTATAGATCAACCTGC
ATCTTTTTTTTGTAGTGATGAAATGTTTCTTAAATGATTT
GGTACTTATTTGTGCACGTGATTGGTGATTCACACTCGTG
CCCGCATACATCTCATTCATTCATGTGTGGTTCAGAGAGC
TAAACTGTGGTGTACATAGTTAAAATATTACTCTTTGTTT
TATGTGTTTCCATGTTGTCTGTTACGGTTTCACCTCTGCT
TTGCTAGTGAGGTAAAGGCGGTGTGTAAATATGAATGGGC
TCCTCTTTGTTTCTGTTGAAATGGTTTGCAGTATTCAGTG
GCCGCACAAACATGACAGAGGTTTGAAGAGGAATTCCAGC
AGCCGTCGTCAAGCCGAAGCAGAAAAGCAAATGTTTTCCA
CAAATTATATTATCAGTGCCTTTTACAATGCATTTGTAAC
CATTGTTACTATTTTATTGTTCTGCCTTTGTTGTGTTACT
GTATATTAATATTCTGAGCGGTTTAGCTAGTTATTTTATT
TACATGCCATGTGTTATCTTCAATACAATCAGCTTGTCTG
TGCAACCGCTTGAATCACTCGTTAATTAAGAAATCATACT
TTATACATTTAAATGTACTGTTTGACTTTTTTCTGTCTTG
TGTTTTTGAGCAAAGCTTTATAAACCTGTTTAGTACAATC
ACATTTTTCAACTGTGTTTTGCACAATAAACCCATGGGTC
TCTTAAACACCAAATAAACACTCATAATAGTATTTAGAAA
TGCATGCATCGGTTAACCAGAGTGGCGATAAAATAGTCTT
ATGAACTCCCTGTATGAGGTATTTGTTCAGATGGGTGGGT
CAGTCAAATTGTTTGTACTCAAGGTCAATATTAAGAGTCT
TCTTATGCAAACAGAACCCTTTATGTCCTATAGGCTCCAA
ATGGCGTATTGTTTTTATTGGTTAATATCCTGTAGCACTT
AAGGGCCCTTCAGCAGTATGATCTTTAGTGTACCAAATAG
AGATCAAAGAAAAGCTTTTGGCGTATCGTACTTTCACCCA
AATGTTATGCAAAGCTATTTTTATATGTGCTGTATATAAT
TCTATGATTTGGGTTTTTTTATGCCATTGTACTTTATTTT
CATGTTCACCAAACATATGCATACAGTATGCTAGAATGAA
GTAAATGTTTCGTCTTAGTATTTTGTTGATTTTAAATTTG
TGATTTTGAGAACAAACGCCTGTGTATTGGAAAAATCCAA
GACAATTGATTAAAATAGAGATGGAACACAATAAAGGAAA
ACCTTTACAAATTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
notch2-201 Contained in:

OTHER notch2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046009 (1)
  • Ensembl_Trans:ENSDART00000123104 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY805407 (1) 7797 bp
    GenBank:AF334944 (1) 4923 bp
    GenBank:EH438786 (1) 970 bp
    GenBank:CT732528 (1) 860 bp
    GenBank:DN767722 (1) 847 bp
    GenBank:CT723367 (1) 793 bp
    GenBank:CT680737 (1) 772 bp
    GenBank:CT609246 (1) 689 bp
    GenBank:CT694031 (1) 667 bp
    GenBank:CO354851 (1) 663 bp
    GenBank:CF569057 (1) 657 bp
    GenBank:EB781526 (1) 595 bp
    GenBank:EB766255 (1) 579 bp
    GenBank:EB934436 (1) 560 bp
    GenBank:AW184512 (1) 554 bp
    GenBank:EB927085 (1) 463 bp
    GenBank:CT598791 (1) 387 bp
    CITATIONS (2)