Transcript

her11-201

ID
ZDB-TSCRIPT-100915-578
Name
her11-201
Previous Names
  • her11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000044305 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044305|OTTDARG00000031795|ZDB-GENE-040824-4 her11|OTTDARP00000035068 her11-001 LG_ FP015860.6 Danio rerio protein_coding KNOWN, 1166 bp
GGTGGAAAGTTCACGAGGCCTACGTCACTGCCACCTCCTA
GCCAATTAAATTCCACCAGGCGGGGTAAAAGTTCCCGTTT
GGTGCGTTTTCATTTCAGCAGTTTCCCATATCCTCGAATG
AAGAGCACACCGACTTTCAACATGACGAAGACAGAAGGGA
TCAAAAGAAGGCTAAAGCCTGTCATAGAGAAGAAAAGGAG
AGATCGGATTAACCACAATCTAGACGCATTAAGAGATCTG
CTCTTCAAGAACACTGCAGACACTCGTTTACAAAATCCGA
AACTGGAAAAAGCAGAGATTTTAGACCTTGCAGTTCAGTA
CATCAAAAAGACTATAAGAAAGACTGAAACAGCAAGGAAT
TCCAATCAAATGGACTGTAAGTCAACCCAGAATCAGTTTG
TTATATCTCCTGCGGGTCCTCTCTACACTAGTGACTACTG
CAGGAGGTTTAAAACATCTGAGCAAAACGAGGTTCTCCTG
AATCTGGGAGTCAGTCAGAACCTAAGTGGTTCTTCCAAAA
CAGGGAATAAACTAGTTTCCCAGAAAGGCTTCCTCTTATC
CCCACCAGGCCAGAACTACCACCAGGAGCTGCTCTTACAC
CCTGAATCATCTTTGTATGGGTCAAGTTTATTGCGTCAAT
CGACTTCTCCCTCCATCTCATCATCATCACAATACAGTTC
TCCGCCATCATCTCCCACTTTTACCAGCACATCCTGCTCT
CCCTCATCGTCTCCCCCTTGTCCTTCAACATCTTGTGCTG
CCTTTCCTGACCAACTGTCTCCTCTAATAACTCCACTTTC
ACTTCAGAGGCCTGTTTTTGTTCCTCAAGCCATTCTGCCC
CACATGACCAGAGATTTGACTCCACCACATTCGCCTGTCC
TGGCTCTTAGACAGGATCCCTTCCCTCTTCCAAACCAGCA
TGCCTGGAGACCATGGAGCTGAAATCTGACCACTCTGTTG
TTCCCCATTTTAGGCACTGCTCCAATGGAGAAATGATGGT
GTTCTCTAAGAGGGACCTTATGGACATATGTTGGGGCATG
TGCACAGTTTTGTCTATTATTATTCAATGACTTGTACTTT
CAATTTACTATTTATTGTTTTATCCAGTGATTGTCTTCAC
TGGTATGTGTGTGATTGCAGCAGTGGAATAAATGAGTTGA
ATCAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations