ZFIN ID: ZDB-TSCRIPT-100915-570
Transcript Name: daxx-203
Previous Name: daxx-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044268 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044268|OTTDARG00000031770|ZDB-GENE-010110-3 daxx|OTTDARP00000035042 daxx-002 LG_ FP085393.7 Danio rerio protein_coding KNOWN, 904 bp
ATCAGTATACTGACCGTCAGCGAACCAGCGCGCCGCATGT
TGAGCTGTACAAAGATCCAGCGCCGAGTTTCAGGATCCGA
GCGCGTAAATGCTGATTTTGAAACACCAGTTTGGATTTTG
ACTGTCTTGATCAATTCAATGCTCAGTGCTCAACAAATTC
GTTCTCCTCCCTTCCGGATGGCCGGAGCAGGGATGGAAAG
CATTGTGATCCTCGATGATGACGATGAAGAAGCAGCTTCC
ACGTCTGCATCCTGTTCTCAAGCCACAGCGCAACACTTAA
AAACACCAGTGAAGAGTCAGCCGGTGCCGGCTCCCACACA
CATCACACAGTCTCCATTCGCCAGCGCGAAGAAGGACACA
CACGTGCTGAAAGTGGAGAATGAGAAACTGTTCAATGAGT
TTGTGGAGCACTGCTCAAAACACTCGCAAGAACATCCAGA
AGTCATGACTTACCTGCAGACCAGATACTCCAAGGCTTTG
CCGACCTTTCTGACGTCTGTGGAGTTTCGTAACACTTTGG
GCCGCTGCCTCACTCGAGCCCAGGCCAACGCTGGCAAAAC
CTTCGTCTACATTAATGAACTCTGCACTGTTCTGAAGCAG
CACACGCCGCGGAAGAGAAGCTCCATACAGTCGCTTTCTG
TCAAGGCCAAACCTGAGGAGAAGAGCAATGGGGTTAATGT
TAAAGAGGACACTCAGGGTGAACAAGACGGAGGAAAAGAT
GTCAAACAGCAGGAAGAGGAGTCAAAGAAAACCAAAAGAG
CTTCGAGAAGACAGATTGCGTATCTGGAAAACCTGTTGAA
AGTGTATAATGAGGAGATCCGCCGGCTTCAGGAGGGGGAT
TTGAGTTTGGATGACTTGGAGAAAGAAGATTCCAGTTATA
TTCAAGAGCACAAACTTAAACGCA

daxx TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA daxx-001 (1) 1781
daxx-201 (1) 3137
daxx-203 904
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
daxx-203 Contained in:
OTHER daxx-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044268 (1)
  • Ensembl_Trans:ENSDART00000124094 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN022017 (1) 947bp
    GenBank:EE324521 (1) 910bp
    GenBank:CO924706 (1) 855bp
    GenBank:AI883093 (1) 524bp
    CITATIONS (2)