ZFIN ID: ZDB-TSCRIPT-090929-23258
Transcript Name: daxx-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002431 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002431|OTTDARG00000002250|ZDB-GENE-010110-3 daxx|OTTDARP00000002155 daxx-001 LG_ AL672216.10 Danio rerio protein_coding KNOWN, 1781 bp
AGATGATGAAGATCTATGAGAAGCTGTGTGAGCTGAAAGG
CTGTAACACTCTGACGGGTCGAGTGATCGAGCAGAAGATC
CCATACAGTGGAACGAGATACCCAGAGATCAACAAGAAGG
TTGAGCGTTTCATCAACAGTTCAGAAGCTCTTCTCAATCC
TCCAGACTACAGCGATATCCTGAAGATTGTGCAGAGAGCC
AACGAGCGCTACAATCTCCAGCTCTCCCGCAAACAGCAAA
CCCAGATCTCCCAAGAAGCCTTCAGAGAGACGGGCAACAA
ACTACAGGAGAGACGACACCTTGACATGGTCTACAACTTC
GGCTCTCATCTCACAGATCCATACAAACCAACATTAGACC
CTGCACTCATGGACCCAGCACTGCATCGTAAACTTCGCTC
TAATAGAGACGTGGCTATCAGCAGCCTGGAGGAGGTCATC
AACAAATACGCCAATAAACAGGAGGATATGGAAGTGGAGG
AAACCAAGAAAAGACAAGACAGAGAAAGACTGAAAAAAGA
GGCTGTTAATGGGCAACAGAGTGAAAGCAAAGAAAAAGAA
AAGGAGGAGCAAGAAGAAAAAGAGAAGGAAGATGAAGAAG
AGGAGGAGGAAGACGAAGAAGAGGACGATTCTTCAGATCC
TGACATTGAAGACGAAATCCAGGCCAGCGAACAACAAGCT
GGTCCAGAAGATGATGAAGAAGATGTGGAAGAGGAGCCTG
CTAACATCAGTGACAACGATCAGCCAATCAATGAAAGCTC
TCCTCTGTCAATCAAATCCTCTGTTCAGGACACAGAAGAG
GATGAGGAGCAGTCTCCGCTCAGCAGCACACATGAAGGAT
CTGCAGAAACAAATACAAACACGAACGGACCTGCTAAACA
GAGCCTCGAGTCCACAGAGATCAAGCCGGAGAGCATCAAG
CCGGAGAGCATCAAGCCGGAGAGCATCAAACCAGAGACCA
TCAAGCCGGAGAGCATCAAGCCAGAGAACACAGACTCTCT
AGCTGAAGTCAAGACCGAACAGGTTTCCTCCAATCACGTT
GAAGCTGTGTCTGCGAGCACTGAGACCGTGTCTATTGTAT
CCGAGGAGTCGTCCACAGCCGTCACGAGATCCGCCAATTG
CAGTCCGCTGCTCCCAACCAGCCCTTTACTAATCGACGAG
ACGGGCAACTACAGGAAGAGGAAACGCAGATCCACAGAGA
ACCACACTTCTGCTCACAACGGGAACTGCACTGAGGACAG
TGATATTCCTCTGGATATGGGAGTGATCTGCTGCTCTGAA
CAGGAAGATCTGACCTGTCTGAAGACACCACCGCGAAAAA
TAGCCAGGAACTCACGATCCACACCACCACCCAAGAAAAA
TAAGGTAAACGTAGCAACACAATGCGATCCGGAGGAAGTG
ATCGTTCTGTCTGATTCCGAGTGAATCCTGCCGTCACAGG
GTACTGAACTGGCAACCAGTCAGCTTCTTGCTCCAATAGT
GCCTGCTAATGTGAACCGAGGACAAAAGGGTTTATTTTAT
TATTTTATTTTAGGATTGGTTCAGTCCGCTTTTGAACCCC
CACCATTCATGCCAGTTTACTTTTTATACATAATGGCATG
CCGTTATTGATTGGGGCTTTCTAGAGGTATTTTGGTATAC
TGTAAATGAGTCTTGCCTCTAAACGTTCTTACTTCACCTC
ATATTTATGCTTTTATTTTTGAGGGTTTGGACACAATCCT
CGTTTCTACCAAGAGTCTTTAGAGGAAGCCAGATTTCTCT
TCTCAATCAATAAACGATCTC

daxx TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA daxx-001 1781
daxx-201 (1) 3137
daxx-203 (1) 904
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
daxx-001 Contained in:
OTHER daxx-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002431 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF137535 (1) 669bp
    GenBank:BI890807 (1) 631bp
    GenBank:BI885975 (1) 602bp
    GenBank:AI667252 (1) 547bp
    GenBank:AW344153 (1) 486bp
    CITATIONS (1)