Transcript

rad54b-201

ID
ZDB-TSCRIPT-100915-362
Name
rad54b-201
Previous Names
  • rad54b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046824 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046824|OTTDARG00000033319|ZDB-GENE-060810-50 rad54b|OTTDARP00000036880 rad54b-001 LG_ BX511010.5 Danio rerio protein_coding KNOWN, 3229 bp
GAGTTTTTGTAAATAGGCAAAGTGATTGACATACGAGAGG
AAACTCGATAACAAGAATGCGCAGATCTGGAGCTCCGAGT
CAGCTCCGTGGAAATGCTGCTAAGAAACCCAGATTTATGC
CACCGGGTCCAGCGAGGAATGATGGAGCACCTTGTTTGGA
TCCCCAACCAGAACCATCACAACCCTCACCGCCTCCCATA
CCTGCTTTAAAAAATGTGCTGCTCAATAAGGTCCAGAGGT
GTTTGAGTAGTGGAGATGCTCCAGCTGCAAGTGATGCTCC
AGTAGGAAGTAAGGCACTAGCCAGGGTCCTTGGTGCTGCG
GTTCCTCAGGGGGAATGTAAGGAAAACCACATCAGGTCTA
TGCCTGACTTTCCTGAACCCGAAGAATCAGTAAATAAAGA
CAGGCGCTCACCACCGCTAAACACTCATGCTAGCTGCACA
ACAACTGCTCACTACTATAGTGTTATATGGTGCAAGGCCT
CTTCAAGGAAGCATAAGCGCTGGGAAGGTGATGCTGTGCT
TGTTGCCAGAGGGCGAACGGTTGTCCTTAAAGACATGGAG
GGCCGGGACATTGGACGAGGTTCAGGTTACAAGGCATCAG
AGCTGGAGAGTTTGTGTGAGGGTCAGACTCTTATGGTTGG
AGGGAAGCAAATAGAGGTCATGGGGGTCATATCTGATCAA
GACTATGCCAAAGGCCGCTGTTTCCAAGATGCGGCTGTCG
AGATTCCTGCAGAAAGCCCTACAGTCTCGAAGACTCCTGC
ATATCGGCCGGTATCCAAATCCTTTACCAAGCCAGCGCTC
AAGGGAGGCGCACTTACAGATTCTGAACTTGACAAACCAA
TCTGTAAACCTCGATATGACCCGAACGCACCAGGAGCCCT
GGTGATGCCACGGCCTACAGCAGATCACCAGTGGCAGTAT
AATAAATCTGGAGCTCCACTGGTTGACGTGGTCATCGACC
CTCACTTGACCAATCACCTTCGGCCACATCAGAAAGAGGG
CGTGGTCTTCCTTTACGAATGCTTAATGGGAATGAGATTG
GCTGGCCGCTGTGGGGCGATTCTAGCAGATGAGATGGGAT
TGGGGAAAACTCTGCAGTGTGTTTGTGTTTTGTGGACATT
ACTCAGGCAGGGGCCCTATGGTGGACGTCCCGTAATGAAA
AGAGCACTTGTGGTTTGTCCTGGAAGTTTGGTGAAGAACT
GGGCTGCTGAGTTCAACAAGTGGCTGGGCAGAGAGAGAAT
CAGTGTTTACACCGTGGACCAGGATCACCGTGTGGAAGAC
TTTGTTTCTTCTCCTCTTTGCTCCGTCCTGGTCATCAGCT
ATGAGATGTTGTTGCGCTCTGTGGACCGGCTGAAAGAACT
GGATTTTGGAGTCCTCATCTGTGACGAAGGTCATCGCCTA
AAAAACAGCAACATCAAAACAGCTGGAGCTCTCACAGCCC
TCTCATGCACACGCCGGCTTATTTTAACAGGTACTCCGGT
GCAAAATGATCTGCAGGAGTTTTATTCAATCATCGAGTTT
GTAAATCCAGGAATTCTGGGAACATCTGCGGCCTACAGGA
AGATTTATGAAGAGCCCATTCTCCGATCTCGCCAGCCCAG
CTGCACCGAAGAAGAGCGGTGTATTGGAGAAGAGCGTGCT
GCTGAGCTCTTTCGTCTGACAGGTGTCTTTACATTACGCC
GCACTCAGGAGATCATTAATCAGTATTTATCTGAGCGGAT
CGAGTGGACTGTGTTCTGCAAACCCACCGAGCTGCAAATT
CGTCTGTACAGGGTACTTCTGTCCACGCGACCCATAAGAG
CCTGTTTGTCTGGCTCTCACACTTACACACACAGCCCTCA
CCTTGTATGCATCAACGCCCTTAAGAAACTCTGCAACCAC
CCTGCACTGCTCTACAACACACTACAGGAAAAGGCAGATG
AGATGTATGAGGGTGAAGTTAAGGAGCTCTTTCCTGAGGA
ATACTCCACCGGCGCCTTCAGCACAGCAGACTCTGGCAAA
CTTTTAGTGTTAACAGACCTTCTGTCAGCCATACAGCATG
TCAATCGCACAGACAGGGTTGTTTTGGTGTCCAACCACAC
ACAGACTCTTGACTTACTCCAGGACGTCTGTGATCAGATA
GGCTATAAATGGTGTCGTCTTGATGGACAGACACCAGTTG
GCCAGCGGCAGAAAATTGTTGATTCCTTCAACAGCCCACA
TTCGTCCAGCTTTCTACTGCTGCTCAGCTCCAAAGCTGGA
GGAGTGGGACTAAACCTCATCGGTGCCTCTCACCTCGTTT
TATATGATATAGACTGGAATCCTGCCAATGACATACAGGC
CATGGCACGAGTGTGGAGAGATGGACAGAAGAAAACAGTT
CATATCTACAGATTTCTCACAACAGGTTCCATAGAAGAGA
AGATTTATCAGAGGCAGGTGAGTAAACAAGGGCTTTCTGG
GACAGTGGTGGACCTGACCAAAAAAGCTGAGCATATTAGC
TTTTCGGCTGAGGAGCTGCGAGACCTTTTTAGGTTTGACC
CTAATACCACCTGCCTCACACATGACTTACTGAACTGCAA
GTGCTCTGGAGATGGAAATACACCAGGTTCTGTGAAGGAG
TCCAGTGAGGACACTGGAAGGTCATGTCAGCTGGGTCGCC
AAGCCGACAACGCAATATCAGTCCCACAGCGAGTCAGCAT
GTCTGAGCTCATGCACTGGAGGCATTTTTCAGGAGCTGTT
CAATCATATGGTGATATTTACCTAAATCAGGCCTGTAACC
ACATTACATATGCCTTTCAAAGCACTTCTAAATCCAAAAC
CACAGTCTAAACTCATACACTTGTATACAAACCCACTGCC
CTTACACTTTGTGGAGGTAACCAATATATATAGTTTAACA
TTAAATTTTTCATTTTTAAATGTTTCTTCATTCATCAAAA
GTTATATTTGTGTGCAGCTAGTGCACTAGTGTCCATTTAG
AGACCCCGCTGATTTTGATATGAGCTCCTTTTGCCAGAAT
GAATCAGAGCAGTGCACAGAAATAGATTAATAACGCACTC
AGAAACATTAATAGAAGAGGGAATAGTCAGACAAATGCAT
GAGCTCAGTCCTGTTTCTATTTTAAACCTGCCTAAAAACA
CAGTTTCTCTTTTAATTTGTCCAAAATGTAGCTTGCCTGT
TTTTGTTGGTGTGTATGGATGCAAATGTCACATTTCGGTC
GGAAATTTCTTATTAAATTATTACATTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations