header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-320
Transcript Name: polr2f-002
Previous Names: ch211-212i14.1-002, zgc:92790-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046648 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046648|OTTDARG00000033224|ZDB-GENE-040718-279 polr2f|no_translation CH211-212I14.1-002 LG_ CR394546.9 Danio rerio protein_coding KNOWN, 888 bp
CTGCAGCACCATCGGAAAATCCTTCCACGCTTGGAGTCGC
GCTGTGGTAAACTAGCTGTGAAATTCCAGACTCAACATTT
TTCTTAAAAAATTACCTATTAAACCGGGTTAGGAGACGCA
GAACACTAATAATGTCGGATAACGAGGACAATTTTGATGA
CGGAGATTTCGATGATGTTGAAGATGAAGAGCCTCTGGAT
GATCTGGAGAATGTGGAAGATGAGGACCAAGAGAATGTTC
AGATCCTGCCGGCAGGTGAAGGACAGCAGGCCAATCAGAA
GAGAATCACCACCCAATACATGACCAAATACGAGAGAGCG
CGAGTGCTGGGAACACGAGCTCTGCAGATCGCGTGAGTGA
CTGATCCACAATCACCACTCAACACAACACACACACACAC
TGCCAAATACACAACATTACTAAACATGGAGATCACACAC
ATGCACACTGCAATGGCTGAATCTCTAAATCATTTCACAG
CATTAATCTGAACGCTCATACTCAGTTCATGTGTCCTTTT
CTCTGTCCGCTGTTTGACTGTGGATTGAAGCATTGCTTTG
GTTTCGCCTAACTTGCTGATCTTGGTGTCTGATATTGTGA
GGTTTTATTTTTCTGTGATAAATATTGTGTTATGAATACA
GTTTCACTAGAGAGTTTGATTGGCTCTATTTGACTGATTT
CTGTGGAGAAACAAATGCTTTTCTTACTTTGCATTCTTTC
GTTTCTAGTCCAAATATCTAAAAGTTCTTAAGAAAAATAT
TTTGTTTTCAACTTTCCATAAACTTACTTTTGAAATTTTT
CCCTAAAACAAACAAAATGATCTGCCTCTTACCCATTTAA
TTAGCATTAATTTCGAGAGGAGCATTAAAGTGCAAAACCC
AACAGAAA

polr2f TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA polr2f-002 888
mRNA polr2f-201 (1) 792
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
polr2f-002 Contained in:
OTHER polr2f-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046648 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN019113 (1) 909bp
    CITATIONS (1)