header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1349
Transcript Name: polr2f-201
Previous Names: polr2f-001, ch211-212i14.1-001, zgc:92790-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046647 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046647|OTTDARG00000033224|ZDB-GENE-040718-279 polr2f|OTTDARP00000036772 CH211-212I14.1-001 LG_ CR394546.9 Danio rerio protein_coding KNOWN, 792 bp
AACCCAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGC
TGCAGCACCATCGGAAAATCCTTCCACGCTTGGAGTCGCG
CTGTGGTAAACTAGCTGTGAAATTCCAGACTCAACATTTT
TCTTAAAAAATTACCTATTAAACCGGGTTAGGAGACGCAG
AACACTAATAATGTCGGATAACGAGGACAATTTTGATGAC
GGAGATTTCGATGATGTTGAAGATGAAGAGCCTCTGGATG
ATCTGGAGAATGTGGAAGATGAGGACCAAGAGAATGTTCA
GATCCTGCCGGCAGGTGAAGGACAGCAGGCCAATCAGAAG
AGAATCACCACCCAATACATGACCAAATACGAGAGAGCGC
GAGTGCTGGGAACACGAGCTCTGCAGATCGCGATGTGTGC
GCCGGTGATGGTGGAGCTGGAGGGAGAGACGGATCCACTG
CAAATCGCAATGAAAGAGCTCAAGAGCAGGAAAATCCCCA
TTATCATCCGCCGGTATCTGCCTGACGGGAGTTATGAGGA
CTGGGGCTGTGATGAACTTATCATTACTGACTGAGAAGCA
CACACAGACATGCACACACGTCATGATCCACATCTGATCT
GTGTGTTTTCAGCACTGGGTTACTGTGTGCAGTTGTTTTA
TGTTCAGCAGTTGTTGTGTTTGTCCACAGGAGGGCAGTAG
GAACACACTGAAACACCAGAGAAAAGAGGAAGATTTCACC
CACAATGTCATAATTTAATGTTCATTTTTGTTTTTATTGT
TGTGCAGAATTAAACCTTTTTGTAGAAAAGAA

polr2f TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA polr2f-002 (1) 888
mRNA polr2f-201 792
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
polr2f-201 Contained in:

OTHER polr2f-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046647 (1)
  • Ensembl_Trans:ENSDART00000053201 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH543784 (1) 825 bp
    GenBank:EH564920 (1) 808 bp
    GenBank:BC076264 (1) 754 bp
    CITATIONS (2)