header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-269
Transcript Name: cpvl-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046448 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046448|OTTDARG00000033012|ZDB-GENE-031219-2 cpvl|no_translation cpvl-002 LG_ CU467871.7 Danio rerio protein_coding KNOWN, 649 bp
TGACAACAACCTGATTTTTAGTTTACTCATGTTTCATCTG
CCAGTGTAAACGGTTTCTGGATTTCTCGTTGGATTTTGGC
CTTTGGCCAAAAAACTGAGTTTGGTGGGTCCCCTTCCTGG
TGCCAATGTCAAGAGTTACTCTGGATATCTCACTGTGAAC
AAGACCTACAACAGCAACCTTTTCTTCTGGTTCTTCCCTG
CCCAGGAGAGACCAGAGACTGCTCCGGTTCTGCTGTGGCT
GCAAGGAGGACCAGGAGGAACCTCTATGTTTGGCTTGTTT
GTGGAGCACGGCCCATATTTTGTATATAAGAATCTCACAT
TGGGCTATAGGCATTTCCCCTGGACATCACGCTATTCAGT
TCTCTACATTGACAACCCGGTTGGGACAGGATGGAGTTTC
ACTGAGGATGACCGAGGGTTTGCCCAAAACCAGGATGATG
TGGGCAGAGACTTGTATAGTGCCCTGACTCAATTCTTCCA
GATATTTAGGGAGTTCCAGTCAAATCCGTTTTATGCTACT
GGCGAGTCATATGCAGGAAAGTATGTTCCAGCGATTGGCT
ACTACATCCACAGGAACAATCCCTCCGCTAAAGTGAAGAT
CAATTTTAAAGGAGTGGCCATTGGAGATGGATTGTGTGAC
CCTGAACTG

cpvl TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cpvl-201 (1)    Ensembl 1775
ncRNA cpvl-002 649
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cpvl-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046448 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BM157090 (1) 659 bp
CITATIONS (1)