header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1258
Transcript Name: cpvl-201
Previous Name: cpvl-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046272 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046272|OTTDARG00000033012|ZDB-GENE-031219-2 cpvl|OTTDARP00000036511 cpvl-001 LG_ CU467871.7 Danio rerio protein_coding KNOWN, 1775 bp
GACACAGCGCCCATGTAGTCATGTGACTGCTGCAACTACA
GCGTGACAACAACCTGATTTTTAGTTTACTCATGTTTCAT
CTGCCAGTGTAAACGGTTTCTGGATTTCTCGTTGGATTTT
GGCCTTTGGACTTCACAATGCTGAAGGAAACGCTGAGGCT
GCTCTTCGTCTGGGCTGTTCTGGAGTCAGTTTGCTCACGC
GGATGTTCCTCATTTTTCTGCCGCAAAACACGTCGGGTGA
GCGGTTCGCGTTTTGGAGCTGACCCGGGCAAACCACTGAT
GCTCACCCCTTATCTGGAGCAAGGCAAGATAGAAGAAGCC
AAAAAACTGAGTTTGGTGGGTCCCCTTCCTGGTGCCAATG
TCAAGAGTTACTCTGGATATCTCACTGTGAACAAGACCTA
CAACAGCAACCTTTTCTTCTGGTTCTTCCCTGCCCAGGAG
AGACCAGAGACTGCTCCGGTTCTGCTGTGGCTGCAAGGAG
GACCAGGAGGAACCTCTATGTTTGGCTTGTTTGTGGAGCA
CGGCCCATATTTTGTATATAAGAATCTCACATTGGGCTAT
AGGCATTTCCCCTGGACATCACGCTATTCAGTTCTCTACA
TTGACAACCCGGTTGGGACAGGATGGAGTTTCACTGAGGA
TGACCGAGGGTTTGCCCAAAACCAGGATGATGTGGGCAGA
GACTTGTATAGTGCCCTGACTCAATTCTTCCAGATATTTA
GGGAGTTCCAGTCAAATCCGTTTTATGCTACTGGCGAGTC
ATATGCAGGAAAGTATGTTCCAGCGATTGGCTACTACATC
CACAGGAACAATCCCTCCGCTAAAGTGAAGATCAATTTTA
AAGGAGTGGCCATTGGAGATGGATTGTGTGACCCTGAACT
GATGCTGGGAGGCTATGCAGATTTTCTCTATCAGACGGGT
CTGGTGGATGAACTGCAGAGGCAGCATGTGAAGATGCAGA
CAGATGCAGGAGTCAAACTGATTCAGGAGCAGCGATGGGT
GGAGGCCTTCCAGGTGTTTGACAGCTTACTGAATGGGGAT
CTTGTTCCTTATCCTTCATACTTCCAGAACGTCACTGGTT
GCACCAACTACTTCAACTACATGCAGTGTCAGGAACCTCC
AGATCAGGAGTATTTTTCTTCATTCGTGACTCTACCAGAG
GTTCGACGCTCCATCCATGTTGGGAATCTGACCTTCAACG
ATGGCTCAGATGTGGAGAAACATCTGCTTCAGGATGTCAT
GAAGTCCATCAAACCCTGGTTGGGCGTCCTGATGGAGAAC
TATAGAGTGTTAATCTACAGTGGTCAGCTGGATGTGATCG
TTGCGGCCCCTCTTACTGAGCGCTTCTTGCCCACCGTGAG
CTGGTCTGGAGCAGACGAGTATAAGACCGCAGAGCGATTC
CCCTGGAAGGTTCAGCCCAGCGACACTGAAGTCGCAGGAT
ACGTTCGACAAGTCAGAGAGTTCTTTCAGGTTATTGTCAG
GGGAGGCGGGCACATTTTACCTTATGACCAACCAGAGAGA
TCATTCGACATGATAGACAGATTCCTCTCTACAGATGGAT
TTACATCTCACTGATAGACTGAGATCAAACATGAAATGTG
ACCAGTGAATGAATCCGTGTTCACTAGCGTAATGTATATT
TCAATGCGATATACCGTGCTCTTATGAAGGCACTGTAATG
GTTTATATTTTTTATTAGGCTCTGTTAAGTGTAAGGGCTG
TTTTATTGTACATGATTTGAAGATGATTTTTGATTAAAGT
ATGATTTGAATTTAA

cpvl TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cpvl-201 1775
ncRNA cpvl-002 (1) 649
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cpvl-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046272 (1),  Ensembl_Trans:ENSDART00000078984 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC051154 (1) 1733 bp
GenBank:EG578567 (1) 932 bp
GenBank:CK682117 (1) 787 bp
GenBank:EB839139 (1) 421 bp
GenBank:BM533741 (1) 384 bp
CITATIONS (2)