Transcript

cpvl-201

ID
ZDB-TSCRIPT-100915-1258
Name
cpvl-201
Previous Names
  • cpvl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046272 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046272|OTTDARG00000033012|ZDB-GENE-031219-2 cpvl|OTTDARP00000036511 cpvl-001 LG_ CU467871.7 Danio rerio protein_coding KNOWN, 1775 bp
GACACAGCGCCCATGTAGTCATGTGACTGCTGCAACTACA
GCGTGACAACAACCTGATTTTTAGTTTACTCATGTTTCAT
CTGCCAGTGTAAACGGTTTCTGGATTTCTCGTTGGATTTT
GGCCTTTGGACTTCACAATGCTGAAGGAAACGCTGAGGCT
GCTCTTCGTCTGGGCTGTTCTGGAGTCAGTTTGCTCACGC
GGATGTTCCTCATTTTTCTGCCGCAAAACACGTCGGGTGA
GCGGTTCGCGTTTTGGAGCTGACCCGGGCAAACCACTGAT
GCTCACCCCTTATCTGGAGCAAGGCAAGATAGAAGAAGCC
AAAAAACTGAGTTTGGTGGGTCCCCTTCCTGGTGCCAATG
TCAAGAGTTACTCTGGATATCTCACTGTGAACAAGACCTA
CAACAGCAACCTTTTCTTCTGGTTCTTCCCTGCCCAGGAG
AGACCAGAGACTGCTCCGGTTCTGCTGTGGCTGCAAGGAG
GACCAGGAGGAACCTCTATGTTTGGCTTGTTTGTGGAGCA
CGGCCCATATTTTGTATATAAGAATCTCACATTGGGCTAT
AGGCATTTCCCCTGGACATCACGCTATTCAGTTCTCTACA
TTGACAACCCGGTTGGGACAGGATGGAGTTTCACTGAGGA
TGACCGAGGGTTTGCCCAAAACCAGGATGATGTGGGCAGA
GACTTGTATAGTGCCCTGACTCAATTCTTCCAGATATTTA
GGGAGTTCCAGTCAAATCCGTTTTATGCTACTGGCGAGTC
ATATGCAGGAAAGTATGTTCCAGCGATTGGCTACTACATC
CACAGGAACAATCCCTCCGCTAAAGTGAAGATCAATTTTA
AAGGAGTGGCCATTGGAGATGGATTGTGTGACCCTGAACT
GATGCTGGGAGGCTATGCAGATTTTCTCTATCAGACGGGT
CTGGTGGATGAACTGCAGAGGCAGCATGTGAAGATGCAGA
CAGATGCAGGAGTCAAACTGATTCAGGAGCAGCGATGGGT
GGAGGCCTTCCAGGTGTTTGACAGCTTACTGAATGGGGAT
CTTGTTCCTTATCCTTCATACTTCCAGAACGTCACTGGTT
GCACCAACTACTTCAACTACATGCAGTGTCAGGAACCTCC
AGATCAGGAGTATTTTTCTTCATTCGTGACTCTACCAGAG
GTTCGACGCTCCATCCATGTTGGGAATCTGACCTTCAACG
ATGGCTCAGATGTGGAGAAACATCTGCTTCAGGATGTCAT
GAAGTCCATCAAACCCTGGTTGGGCGTCCTGATGGAGAAC
TATAGAGTGTTAATCTACAGTGGTCAGCTGGATGTGATCG
TTGCGGCCCCTCTTACTGAGCGCTTCTTGCCCACCGTGAG
CTGGTCTGGAGCAGACGAGTATAAGACCGCAGAGCGATTC
CCCTGGAAGGTTCAGCCCAGCGACACTGAAGTCGCAGGAT
ACGTTCGACAAGTCAGAGAGTTCTTTCAGGTTATTGTCAG
GGGAGGCGGGCACATTTTACCTTATGACCAACCAGAGAGA
TCATTCGACATGATAGACAGATTCCTCTCTACAGATGGAT
TTACATCTCACTGATAGACTGAGATCAAACATGAAATGTG
ACCAGTGAATGAATCCGTGTTCACTAGCGTAATGTATATT
TCAATGCGATATACCGTGCTCTTATGAAGGCACTGTAATG
GTTTATATTTTTTATTAGGCTCTGTTAAGTGTAAGGGCTG
TTTTATTGTACATGATTTGAAGATGATTTTTGATTAAAGT
ATGATTTGAATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations