Transcript

rgs11-202

ID
ZDB-TSCRIPT-100915-160
Name
rgs11-202
Previous Names
  • rgs11-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046016 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046016|OTTDARG00000032867|ZDB-GENE-080220-46 rgs11|OTTDARP00000036308 rgs11-002 LG_none BX927386.11,BX548256.7 Danio rerio protein_coding KNOWN, 1449 bp
GCTCTCTTCAACTTTACATCCACAGCAGCAGAAAACATGA
CCATCAACACACTCAGCCAGGATGGCGTGCAGAGACAGCA
AATGCCCTGTTTGACCAAGATGGAGCGCATGATCATTTCT
ATGCAGGACCCCGATATGGGCATCAAGCTGCGCAACCAGC
GTCTGCTTATTACAGTCATCCCACATGCAATGACCGGTGC
AGACATTGTTGAATGGCTGATTAAGAAGTTAACTATTTCT
GATGAAGAAGCAGCGCACATTGGACAGTTTCTCGTGAAGT
ATGGCTACATTTACCCTTTAAAAGAACCCAGAAACCTTAT
TCTGAAAGCTGACGAATCAGCATATCGTTTTCAGACACCG
TATTACTGGATGTCTACACGCTGGCCTGCTTCAGAACTAG
ACTATGCAATCTACCTGGCCAAGAAGAATATCAGAAAACA
AGGAGAATTAATCGAGTATGAAAAGGAGTGCTATAATGCT
TTACATAAACGTATCAACCACACCTGGGACTTTGTTGTGA
TGCAGGCAAGAGAGCAGCTCAGGGCATCAAAACAGCGTCG
GAAGGCAGATCGTATAGTGCTGGAGTGTCAGGAACAAGCG
TTCTGGCTAGTGAACAGACCTCCTCCGGGGACACTGGATA
TTATGAATTATGGGCCCGAGAGAAGAACAATGAACACACG
CGTGCAGCTGAATGCAGAATTCTACAAAAAAGAGATTGAA
CACAACAGGATGAGCCTGGCGAGGAATCGTGTCAAGTCCT
CAATCTGCCTTGAGAGCTATGTGAAGTACTGTGAGCAGTA
CCAGCCTCATGACCCCATAATGCAAGGGTGTCTTCCCAGC
AATCCCTGGATTACAGATGATGTGCTGTTTTGGAACATGA
ACTCTGAAGCGGTTACTGTTCCCACTAAACTGCGTGTGGA
GCGCTGGAGCTTCAGCTTCACGGAGCTGCTGGACGACCCG
ATGGGCAGAAAAGAGTTCCTCATTTATCTGGAGAAAGAGT
TCAGCGCGGAGAACTTGTGCTTTTGGCAGGCCTGTGAGGA
CGTTCGTCATGGAGAGAGCTCCAAAATTCCCGAGAAAGTG
GACGAGGTTTACAAGCAGTTTCTGGCTCCTGGTGCAAGTC
GCTGGGTGAATATCGACAGCAAGACCATGGAAAAAACCTT
GGAAGGGCTCAAGCGTCCTCATCGTTTTGTTTTGGATGAT
GCTCAAATGCATATTTACTTCCTCATGAAAAAGGATTCGT
TCCCTCGCTATTTGAAATCTGATCTCTACAAGAGCTTATT
GGCCAGAGCCATTGTGCCACAGGAGACCAAGAAAAGTGTG
TTCCCGTTCATGCGTCGGCAGCGCCACTCCAGCCCCTCGC
CTGCTCTCGTCACCCATACCACAGAGGATGATGGGAAGGC
AAAAAACTCAAACTCTGTCAAAAGCAATTCTGGAACCGCG
TCCAGGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations