Transcript

rgs11-201

ID
ZDB-TSCRIPT-100915-1189
Name
rgs11-201
Previous Names
  • rgs11-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046015 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046015|OTTDARG00000032867|ZDB-GENE-080220-46 rgs11|OTTDARP00000036307 rgs11-001 LG_none BX927386.11,BX548256.7 Danio rerio protein_coding KNOWN, 1695 bp
TTCAACTTTACATCCACAGCAGCAGAAAACATGACCATCA
ACACACTCAGCCAGGATGGCGTGCAGAGACAGCAAATGCC
CTGTTTGACCAAGATGGAGCGCATGATCATTTCTATGCAG
GACCCCGATATGGGCATCAAGCTGCGCAACCAGCGTCTGC
TTATTACAGTCATCCCACATGCAATGACCGGTGCAGACAT
TGTTGAATGGCTGATTAAGAAGTTAACTATTTCTGATGAA
GAAGCAGCGCACATTGGACAGTTTCTCGTGAAGTATGGCT
ACATTTACCCTTTAAAAGAACCCAGAAACCTTATTCTGAA
AGCTGACGAATCAGCATATCGTTTTCAGACACCGTATTAC
TGGATGTCTACACGCTGGCCTGCTTCAGAACTAGACTATG
CAATCTACCTGGCCAAGAAGAATATCAGAAAACAAGGAGA
ATTAATCGAGTATGAAAAGGAGTGCTATAATGCTTTACAT
AAACGTATCAACCACACCTGGGACTTTGTTGTGATGCAGG
CAAGAGAGCAGCTCAGGGCATCAAAACAGCGTCGGAAGGC
AGATCGTATAGTGCTGGAGTGTCAGGAACAAGCGTTCTGG
CTAGTGAACAGACCTCCTCCGGGGACACTGGATATTATGA
ATTATGGGCCCGAGAGAAGAACAATGAACACACGCGTGCA
GCTGAATGCAGAATTCTACAAAAAAGAGATTGAACACAAC
AGGATGAGCCTGGCGAGGAATCGTGTCAAGTCCTCAATCT
GCCTTGAGAGCTATGTGAAGTACTGTGAGCAGTACCAGCC
TCATGACCCCATAATGCAAGGGTGTCTTCCCAGCAATCCC
TGGATTACAGATGATGTGCTGTTTTGGAACATGAACTCTG
AAGCGGTTACTGTTCCCACTAAACTGCGTGTGGAGCGCTG
GAGCTTCAGCTTCACGGAGCTGCTGGACGACCCGATGGGC
AGAAAAGAGTTCCTCATTTATCTGGAGAAAGAGTTCAGCG
CGGAGAACTTGTGCTTTTGGCAGGCCTGTGAGGACGTTCG
TCATGGAGAGAGCTCCAAAATTCCCGAGAAAGTGGACGAG
GTTTACAAGATTCGTTCCCTCGCTATTTGAAATCTGATCT
CTACAAGAGCTTATTGGCCAGAGCCATTGTGCCACAGGAG
ACCAAGAAAAGTGTGTTCCCGTTCATGCGTCGGCAGCGCC
ACTCCAGCCCCTCGCCTGCTCTCGTCACCCATACCACAGA
GGATGATGGGAAGGCAAAAAACTCAAACTCTGTCAAAAGC
AATTCTGGAACCGCGTCCAGGCTGTAACACAAAATATTTG
CTTGTGCTTAAAACACTTGAATTTATTTTCTGCCGTATGT
TGTTACCTAACACACTTGGGAAAGGAAACTACACTGTTTC
CTTTTGTGCTCCACAAAGCAGATATTTTAGCCTCTAGGTT
ACTGTTTAAAAATAATTCTCATCATATCAGGCTTGCATTT
TAAAGATACAGCAATAATGCCATTCAACATAATCACAATC
ACATACAGTAAACGTTCAGCTCTTCTATGAATGTGTAACT
CAAATCTTTCGCACATTTGTCATGTTTTTAACGTGTTTAT
TTGATATTAAATGTTCTTTGTGTTATACATTTACTGTTGC
CTCCGTTTACATAAATCAACATGATGTCTTTTAAAATAAA
TGTGTACATTTGGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations