ZFIN ID: ZDB-TSCRIPT-100915-153
Transcript Name: gpr143-202
Previous Name: gpr143-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045985 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045985|OTTDARG00000032850|ZDB-GENE-040426-1476 gpr143|OTTDARP00000036285 gpr143-001 LG_ CU469547.8 Danio rerio protein_coding KNOWN, 864 bp
TGACGTCTCTGCTCAAGGGTCAGCAGGGCATTTACACGGA
GAACGAGAGGAGACTCGGCTCTGAGATCAAAATACGCTTC
TTTAAGATCATGCTGGTGTTCTTCATTTGCTGGCTGCCCA
ACATCATCAACGAGAGTCTGCTGTTTTATCTGGAGATGCA
GGACGATGTTAAATCCAGCGATCTGAAGAACATTCGCAAC
GCCGCGCTAATCACATGGTTCATCATGGGAATCCTGAACC
CCATGCAGGGCTTTCTGAACACGCTGGCGTTTCACGGCTG
GACGGGTCTGGATCTGGACTTCAGTCGGCAGAGACGTCGC
GAGCTGCCCTGGGACTCGGCCTCCACATCTCTTGCTGGAG
GATTCACTCCTGCGGTCGGATCATCTTTAATTTACCAGAG
CCACGTGCAGGAGATCAAGAAAAACCTGAGCGCCAACGGA
GGCCAGCAGCCGTCGGACGCCATCAGTGTGCTTTCTGAAG
ATTCAGAGTCGAGTACGGTAGAAATCCACATTTCCAGCGA
ACAGAGAGAGTTTGAGGAGCTGAAGCGAAACGGAGCATCG
TGGGAGATTTCTACAGGCTAAAGAGTCAGAAGAGTCATTT
GCTGATCAGCGATTCCCTGAACAAATGCTTCTGTCTGAGG
CCCGTTTCTGTTCAAGATTTCTCTAAGAACTTCTCCAGAC
TTTAAGTTTTAATGCTTTAACCTGCACTTTGAGCAATATC
TCTGGTTAAACTGTGTTCCTGACATCACTCTAGGCTACCT
TTTGAGTGTTTTGTTTTAATCCTCTGTAATTCAGTGTACA
CTATTACGTGCTTCGGGTCGCCTTCACTAAAGCTCTACAA
TAAAGCAGATCCATTGAACTTCAA

gpr143 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA gpr143-202 864
gpr143-203 (1) 646
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpr143-202 Contained in:
OTHER gpr143-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045985 (1)
  • Ensembl_Trans:ENSDART00000133864 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065340 (1) 1712bp
    CITATIONS (2)