ZFIN ID: ZDB-TSCRIPT-100915-1420
Transcript Name: dnm1b-202
Previous Names: dnm1b-001, ch73-310g9.3-001, si:ch73-310g9.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046926 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046926|OTTDARG00000033373|ZDB-GENE-100920-3 dnm1b|OTTDARP00000036944 CH73-310G9.3-001 LG_none CU929237.12,CU856222.10 Danio rerio protein_coding NOVEL, 2925 bp
TGGAAAATTGAATCAAACGCTGTAAGGGACAGCTTTTAGA
TATTAAGGGTCCTGCCAGACCCAGTGAAGACTCCATATAG
GGTCGAATACATCCGTTTTTTTCATTCACCGTGAAACAGA
GCCTATTATTTACTCCTCAAGATGGGCAATCGGGGAATGG
AGGACTTGATTCCTCTGGTAAACCGAATGCAGGATGCCTT
CTCAGCCATCGGACAAAATGCCAACCTGGACCTGCCTCAA
ATCGCGGTGGTGGGCGGTCAGAGTGCTGGGAAAAGCTCGG
TTTTGGAGAACTTCGTCGGGAAGGATTTTCTGCCTCGTGG
ATCTGGTATTGTCACTCGGCGCCCCCTAGTGCTCCAGCTG
ATCAACTGCCCTACTGAATATGCTGAGTTTTTACATTGCA
AGGGGAAGAAGTTTACAGATTTTGATGAGGTCCGCCAGGA
GATTGAGGCGGAGACAGATCGCATCACCGGCCAAAACAAA
GGCATTTCGCCAGTCCCTATCAATCTGCGTGTCTATTCAC
CTAATGTCCTGAACCTCACCCTCGTGGATTTACCTGGTAT
GACCAAAGTGCCCGTCGGGGACCAGCCGGCTGACATTGAG
GCCCAGATCAGGGATATGCTAATGCAGTTTGTGACTAAGG
AGAACTGCTTGTTGCTGGCCGTGTCTCCTGCCAACTCTGA
TCTGGCCAACTCAGATGCCCTCAAGATTGCCAAGGAGGTG
GATCCTCAAGGTATGAGAACTATAGGTGTGATCACTAAAT
TGGATCTAATGGACGAAGGAACCGATGCACGTGAAATCCT
TGAGAACAAGCTTCTTCCCTTACGCAGAGGCTACATTGGG
GTTGTGAACCGCAGTCAGAAGGACATTGATGGCAAGAAGG
ACATCACTGCGGCCATGAGTGCTGAAAGGAAGTTTTTCCT
CACCCATCCGTCCTACCGACACCTGGCCGATCGCATGGGG
ACTCCATACCTGCAAAAAGCGCTTAATCAGCAATTGACTA
ATCACATCCGAGACACCCTGCCGGGACTGAGGAATAAACT
TCAGAGCCAGTTACTGTCCATTGAGAAGGAGGTGGAGGAG
TACAAGCACTTCCGCCCTGATGATCCTTCCCGCAAAACCA
AAGCTCTGCTACAGATGGTGCAGCAGTTTGCGGTGGATTT
CGAGAAGTGCATCGAGGGTTCAGGAGATCAGGTGGACACG
GTGGAGCTTTCCGGAGGTGCGAGGATCAATCGCATCTTCC
ACGAGCGCTTCCCCTTTGAACTGGTTAAGATGGAGTTTGA
TGAAAAAGAGCTGCGGAAGGAGATCAGTTACGCCATCAAG
AACATTCACGGTATCAGGACCGGTCTGTTTACTCCAGACA
TGGCTTTCGAGACTATTGTTAAACGGCAGATCGCCAAGAT
CAAAGAGCCATGCCAGAAATGTGTAGACCTGGTCATCACC
GAGCTGGTCAATACAGTCAGGCAGTGCACAAAGAAGCTGG
CCCAATACCCCATGCTTAGAGAGGAAATGGAGAGGATTGT
CACCCAGCATATCCGCGATCGAGAGAGTCGCACTAAGAAT
CAGGTCATGCTGCTAATAGACATTGAGTTAGCCTACATGA
ACACCAATCATGAGGATTTCATTGGCTTTGCAAACGCCCA
ACAGAGAAGCAGTCAGATGAATAAGAAGAAAGCTGCTGGC
AATCAGGATGAGATAATGGTGATCAGAAAGGGTTGGCTCA
CCATCAATAACATTGGCATCATGAAAGGAGGAGCGAAGGA
GTACTGGTTTGTCATGACCGCTGAAAATCTGTCCTGGTAC
AAGGATGATGAGGAGAAAGAGAAGAAGTACATGCTGCCAT
TGGACAACCTGAAACTCAGAGATATCGAGAAGAGTTTCAT
GTCCAGCAAGCACGTGTTTGCTCTCTTCAACACTGAACAA
AGGAACGTATATAAAGACTACAGGCAGTTGGAGTTGGCTA
GCGACACTCAGGAGGAGGTGGACAGTTGGAAAGCATCCTT
CTTACGAGCTGGAGTTTACCCAGAGCGCATCACTGACAAA
GAGAAGCAGAGTGACACCAGTGACGAGAGCAGCTCGGATG
GCTTCATGCACTCCATGGATCCTCAGCTTGAGAGGCAGGT
GGAGACCATCAGAAACCTTGTGGATTCCTACATGGCCATT
GTCAACAAGACTGTGCGGGACCTCATGCCCAAGACCATCA
TGCACCTCATGATCAACAATACTAAGGACTTCATCCATGC
TGAGCTGCTAGCTAACCTGTACTCATGTGGAGACCAGAAC
ACTCTGATGGAGGAGTCTGCAGAGCAGGCTCAGCACAGGG
AGGAGATGCTGCGCATGTACCACGCTCTAAAAGAGGCCCT
GAACATCATCGGGGACATCAGCACCAGCACCGTCTCCACT
GCCATGCCTCCACCGGTCGATGACTCCTGGCTGCAGGTAC
AAGGAGGACCTTCAGGGCGCAGATCTCCAATGTCTAGCCC
CACTCCTCAACGCCGGGCCCCACCGGGACCCCCTCGTCCA
GGTGGACGCACTGCTCCAGGACCCCCTACTATTGGTGCTC
CTCCTGTGCCATCCAGACCCGGAGCCTCTCCAGACCCCTT
CGGTGCCCCTCCACCACAGGTCCCCTCTCGTCCCAACCGT
GCACCACCCGGTGTCCCCAGAATTTCTATCAGTGACCAAT
GAGGAGTTACGCAAATGTCCTTCTGTACGTCTGCGTTCAT
CAATCTCTCTGTTTTCATCTCTGAAGTCGGAGAGCGCCAG
CCTCAAACACCAGAGCCAACAGAGACTCAGCAGACAGAAG
ATAAACACTGACACACAAGCACACACAGTCCACATACAAT
ATATGTTTACTTGAAGAAGTACTTTCTCTTCTACAAATAT
ATACGCCAAGAATGAACATTAGTGATATTTTAAATCGATC
TAATA

dnm1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dnm1b-202 2925
ncRNA dnm1b-002 (1) 774
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dnm1b-202 Contained in:
[BAC] CH73-274K23 (1), CH73-310G9 (1)

Genome Resources: Vega_Trans:OTTDART00000046926 (1),  Ensembl_Trans:ENSDART00000134261 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW826975 (1) 378 nt
CITATIONS (2)