ZFIN ID: ZDB-TSCRIPT-100915-1392
Transcript Name: galnt1-202
Previous Names: galnt1-001, ch211-194b7.3-001, si:ch211-194b7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046826 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046826|OTTDARG00000033321|ZDB-GENE-030131-2360 galnt1|OTTDARP00000036882 CH211-194B7.3-001 LG_none BX548254.7,CR391952.12 Danio rerio protein_coding NOVEL, 4221 bp
GTCTCCGTTAGACCGAGTAGCGGCGCTCAGTGCTTTCAGC
CGGAGCGCAGCGCTCATCCCGCGGACGGACTGTCCTCGAT
CCTCGGCCAATTTACACCATAATTGCCAACGAACAGGCCG
CCCCGCGCACACTAAACTAACGGCTTATCATCCTCCTCGG
AGCGACACTGCGGATTTTGAGAAAAGCGCTATATTTCGGG
CCAGCTCTTTGCTCGATCATGTTTGGGATTAATTTTTGAG
GTACTACGATCTGAAGATCACATTTTTTCAGCGTGTGGAG
CCTCAGATCTGCACCGGGACGAAGCGGAGGGTTTCTGTTC
TCGTCTCGTGCGCTGTCGAAAACAGAAAAGAGAGCATGCG
TGAGTAGCAGGATTCTGTGGCTCCTCCCCTCATCTGGAGC
CCCTGCGCTGTAGGACACGAGACCCCCTTGCTTCTCCTAC
TCTAACCTCAGTTCAACAGGTGTGAAGATGAGGAAGTTTG
CGTACTGTAAGGTGGTGCTGGCCACCTCTCTGGTGTGGGT
GATGCTAGACATGTTCATCCTCCTCTACTTCAGCGAATGC
AACAAGTGTGACGATAAAAAGGAGAGAGGATTGCCGGGGA
GAGACACCGTGGTTCAGAGGCCTCATGATGGCCCCGGGGA
GATGGGCAAACCAGTGGTCATCGCTAAAGACCAGCAGGAG
AAGATGAAGGAAATGTTTAAGATAAACCAGTTTAACCTGA
TGGCCAGCGAGATGATTGCGCTCAACCGATCATTACCGGA
CGTCCGGCTCGAGGGATGTAAAACGAAAGTGTATCCAGAT
GATCTGCCGCGCACCAGTGTGGTGATCGTGTTTCATAATG
AAGCATGGACCACACTGCTCCGGACGGTGCACAGCGTCAT
CGACAGGTCACCTAGACACCTGCTGGAGGAGATTGTCCTG
GTGGATGACGCCAGCGAGAGAGACTTCCTAAAGCGGCAGC
TGGAGCATTATGTGCGGAAGTTGGAGGTTCCTGTGAGGGT
GGTGAGAATGGAGCAGCGCTCAGGCCTGATTCGCGCTCGG
TTGAAGGGGGCATCAATCTCCACAGGTCAGGTGATCACCT
TTCTGGATGCCCACTGTGAGTGCACCACCGGCTGGCTCGA
GCCTCTGCTCTCTCGCATCAAACTTGACAAGAAAACCGTA
GTGTGTCCCATCATTGACGTGATCAGCGATGACACGTTTG
AGTACATGGCAGGCTCTGATATGACATATGGTGGGTTCAA
CTGGAAGCTGAACTTCCGCTGGTATCCTGTCCCACAGAGA
GAGATGGACCGCAGGAAAGGAGACCGAACGCTGCCTGTCA
GGACCCCGACAATGGCAGGTGGCCTCTTCTCCATAGACAG
AGATTATTTCCAGGAGATCGGCACATATGATGCAGGAATG
GACATCTGGGGAGGAGAAAACCTGGAGATCTCATTTAGGA
TTTGGCAGTGTGGCGGGACGCTTGAGATTGTCACATGTTC
TCACGTCGGTCACGTGTTTCGTAAAGCAACGCCTTACACG
TTCCCTGGTGGAACTGGGCAAATCATCAACAAGAACAACA
GACGGCTGGCAGAGGTCTGGATGGACGAGTTCAAGAACTT
CTTCTACATCATCTCACCTGGTGTGACGAAAGTGGATTAT
GGAGACATCTCAACCAGAACATCCCTGAGACAGAGACTGC
AATGCAAGCCCTTCTCCTGGTACCTGGAAAATGTCTACCC
AGACTCACAGATACCACGCCACTACTACTCACTGGGAGAG
ATCCGTAATGTGGAGACTAACCAGTGTCTGGATAACATGG
CCAGAAAAGAGAATGAGAAAGTGGGCATTTTCAACTGCCA
TGGCATGGGCGGTAACCAGGTTTTCTCATACACAGCCAAT
AAAGAGATCCGAACTGATGATCTCTGTTTGGATGTTTCCA
AACTCAATGGCCCGGTTATGATGCTCAAGTGCCATCATTT
GAAAGGCAACCAGCTCTGGGAATATGACCCTGTGAAGCTG
AGTCTGGTACACGTGAACAGTAATCAGTGTTTGGATAAGG
CATCTGAAGATGACAGTCAGGTGCCCAGCGTCAGGGACTG
CAGCGGGGCCCGTTCACAGCAGTGGCTTCTCCGCAACGTC
ACACTGCCCGAAATATTCTGAGATCACACACACAGACGGA
CAGATGGGGAGACTCTCACAGTGTCGCTGATGTAGAGAGC
GCGAGAGAAAAAAAACAAAAAACAATACTGCTTTTCCTCT
CAATCCCAGTGGTCTGCCTTCAAAACGATCTGAAAAAACA
GAACCGCATATGTAAATGAATCTCCCATCACTCCACCTTG
CCGAGGACAACGAACGAATGATGGAGAGAGAGACTCGTGG
AGAAAGAAACTTGAGTTTGATGCCCTTATCCTGCTCATTC
CTGGAGCAAGCGGGCATTTTGGTTATGTTTACGAGAACGC
CTCCCTTTTAGAGTATCAGCGTGTGTTAATGTGTGTGTGA
TGCGAATGCGTGAGATGTCAGTCATGTCTTCTTTTTTATT
TAAGTGTTTTTCAAGCCTTGTAGAAGTGAAGGGTATTTAG
CACATGAAGGAAAGGCTGACGTGTGTCTGAGTGCATGTGT
GCATGTGGGATTTAAAGTGTGTCACATATCCAGTGGACGT
TCCAGTAGTCTGGTATCCGATTGAAGCAGGGGCTCCCCCT
ACTGGCCACAGACATACACACACACACACACGCACATGCA
CACATACTGACCTGTCTATCAACCTCCGTCTCAGCCAGTG
GACTACCTGCAATTCCTCACCGTATTGATTTATCATCAAT
CAACAGGATGAATGATGAAAATCTAGGATGTGTTTCATAT
CATCATCGCTAATGTCACTTTTTTTTAAAACTATTTTTTG
TTATTTTTTTGGATTTTAGGTGCCACATACAAGCACTTTT
CACTTGTTTTGCTGTTTGTTTGTTTGTTTTTATTTAGGAC
TTTATGTCAAGTTTGTTTCTTAAAGGTATGATGGTAATTT
AAATACACAAAAACCCTGAATTGTTGCCTTCCTCCGGGTT
TCCAGCCCTTCGGTCGACATGGTTTAGCGCTTGGGTTGAT
CGAGAATGGATGGATCATATTTTTTGTCATATCGTTCAAC
TGTACAAGGGCTCGGTCTCACTGTGTTCATGTGCAAGAAA
GAAGTCTTTCGTCTGATATCTTCTTTTGGTTTTGTTTACG
CTCTCTTTAAATCTGATTCTGTGTAGAATTTGTTTAATTC
ATCAGTGTATTCGGTGTCTGAAAGTTGCCGCTCAACACAT
TTCAGCTGATGTCTTCAAATAGTCAGATAGCCTAAAGAGA
TTGTCACGCATTTCATTCTTTGGATTTTATTTTCATGTGA
AAGGAGATTTAATTTCAGCTGCAACGGCTGAAAACAAGAA
AACCCATTGTTTTGAGATTTGTCGTGGATTCTGGAATCAG
TTTTTGTTTCCCTTTTAAATTCTTGACCCTGTCTAAATAC
TTAAAATGATCTGTACTTTTTGGGTCCTGACCATTATTTT
TGACTCTTAATGCATTTCTTATCTTTATATTGATAGAAAG
TATGGCACCATGTACCAAAAATATTCAAAATTGTAAAATA
TTTTAAGGTACTAAAGTGTTCAGAATGCAGATTAAAAAAT
AAATTTAACAGATTCTAAATTCTAAGATGAAAAACAGAAA
ATATTCTGCAGAAAAAAAATATTTTTTATCAAGATTTTTC
AAACAGACTTTAAAATGCAGATCCTAAAAATAATCATAGA
TTGTAAATCGTGTGATTCTGCAAATTATTGTACATTTTAA
GACTGTAAATGCAGATGTTTGATTTTTAACAAACATAATA
TTCTAAAAACATTTAGGGTTCTAGGTTTTAAAGTAATTAT
ACGTAAAGTTTGAAAAAAATGGCGAAGCTCTAAATTGAGA
AAGCAGATTCTAGGTTATAAACTTTATCGTTTGATTTAAA
GCGATTGTAGATTCTAATGAATAAGAGTGAAGTTTGACTG
CAGAGATTGGTCTTGTAAGTATTTGGACAGGCCTCAAGAT
CATGTGTAGAGATGTGTGAGTGTGAATTAGTGTGTGTGTT
TCTATTCGTCAAAGGGATGTCTTTTGTTTTTGTCTTATTT
GTTGAACTGATGAGGGTCTGGCCTGCTGAATGGTGGGTTA
GAAAGCCCTGTGTCGAGATAATCCACAGGCTGGAGTAATA
AACCACAGAAAGTTTACAGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
galnt1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000046826 (1),  Ensembl_Trans:ENSDART00000140673 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CA975493 (1) 897 nt
GenBank:CT660565 (1) 834 nt
GenBank:CT668460 (1) 775 nt
GenBank:CT668459 (1) 744 nt
GenBank:CK698882 (1) 720 nt
GenBank:CK681390 (1) 689 nt
GenBank:CT683500 (1) 622 nt
GenBank:BQ131172 (1) 608 nt
GenBank:AL918376 (1) 539 nt
GenBank:CD587143 (1) 313 nt
CITATIONS (2)