Transcript

gtf3c6-201

ID
ZDB-TSCRIPT-100915-1236
Name
gtf3c6-201
Previous Names
  • gtf3c6-001
  • dkey-91i17.3-001
  • zgc:56388-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046192 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046192|OTTDARG00000032967|ZDB-GENE-040426-1009 gtf3c6|OTTDARP00000036455 DKEY-91I17.3-001 LG_ CR936322.22 Danio rerio protein_coding KNOWN, 903 bp
GTAAACGAATCAGACCCCCCAGTTAACTACTTCCGTCGCG
TACATTATGCGAAACAATTCGTCGCTAACTTAGATGTTAA
GCGTTTCAATACACGAGTTGCATCTTCGTCTCATCGTATA
GATAAACAAATAGTCTTTTTAGCCATGGAAGACGAGTGGG
AAGAGGAAGAGCAGATGGTTGTGGCTGAACTGTCAGGAAT
GATCAACTCTGACTTAATCTCCAATCGGCAAGGCACCTGC
AAGATAGTGGACATCGACAGCGAGCAGCCCATGCTGCAAG
TCGGCCGGTATCTGTTCACCGGTGAGTACGAGGACGCTAT
CGGGACATGCGTGATCTTTGAGGAGGACAGGTCATCTTCT
AATGCAGCACTTAAATACAAATGTCACACAATGAAGAAAC
TGATGCTGCAGCGAACGTTTCTGTCAGAGAGGAAAGAAGA
CGAGCCCGTCTCCAACCGCATAGAGGTGCTGGCTCTCAAC
GAAGAAGAGTCGTTCGGTCGGAAGAGCGTTTGTCACTACC
TGGACCCCATAGAGACGGACAAATCTGTCCTTGACGAATC
TAAAGACTGTGAGGACCCAGAGAAGAGCGGTGGATCAGCA
GATGAAATGGACGAGACGCTTCTGGAAAACGAGACGATGA
ACGCCAGCAACTCTCTTTTACCGGAGTCTGTGCAAGAAGA
GGACGAGAGCCCCTGAAATACTTTTACTAATGTACATTCT
GTATAATGTAAATATAAGCTTTTTTGGTTAAAGTTTTGTC
CTTTGCTGACATGAATGAACGTCTGTCTTATTTTGTCTGT
TTTACCCATAGTTTTACCATGCACTAAGCGCCAAAACATG
TCTTTATGGTTGGAATGGATATTGTAAAAGAAACAGAAAA
AAACATCAAGCAAAACAATAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations