header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1225
Transcript Name: en1b-201
Previous Name: eng1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046150 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046150|OTTDARG00000032945|ZDB-GENE-980526-6 eng1b|OTTDARP00000047651 eng1b-001 LG_ CU861653.11 Danio rerio protein_coding KNOWN, 781 bp
GAAAGAGTTTGTTAAGCGCGAGCTGTCACACGGGGCAGCG
AGTCAGGGACTGCGGAGCATCGCGCGATGTATTGTCTGAC
ATGAATAACGGGTGTGTTTTGACACTTGAAACGCCTTGAT
CGCGGAAAGCATTCCGATGCTATGACAGTCGCTTCTTTTA
AGGTATTTCGTATACCTTTAATTTAACACTATAGACTGCA
TTCTTGTTTGTTGTTATCCGGATACTGTTCATTGCAACAA
GTGGAATTTTGGTGTGCAGACCACGATCCAGCTGTCATGG
ACGAGCAAAAGGATCAAAATAGTCGTGATTCGACTGAGTC
TGAGAGCGTCTCGCTCTCACCCAATATACCATCTCCTCCG
ATTTTACCTCACCAGGCTGCGCAGCAAGCCCACAGAACCA
CGAACTTTTTCATCGACAATATTTTAAGGCCAGATTTCGG
CTGCAAGAAAGATCCTGGGAGTAGGGATCGGGCGCAAACG
TCGGGTAGGGAGAATGTTAACCCAATGGTAATAAGGCCGT
CGCATAATAGCAGTCTTTGCCAGGATTCAAACTGCAGTAG
TGACAGCACTTCTTCGTCCTCGTCGTCTTCGCCATCCTCA
AAGCAGTCCTCGGTAAAGCATTTCGAAGGAAATGGATCTA
CCGCAGCAAGGAACGGGGAGAATACGCCGTCGATAATGAT
GGTGAACGCCAACGGGGGAACTCCGCCAGCTAAAGAATCA
CAGCCTTTACTATGGCCTGCGTGGGTGTACTGCACCAGGT
ACTCGGACAGACCTTCATCTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
en1b-201 Contained in:

OTHER en1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000046150 (1)
  • Ensembl_Trans:ENSDART00000163488 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091669 (1) 1605 bp
    GenBank:BC165537 (1) 892 bp
    CITATIONS (2)