Transcript

wwtr1-201

ID
ZDB-TSCRIPT-100915-1222
Name
wwtr1-201
Previous Names
  • wwtr1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046137 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046137|OTTDARG00000032940|ZDB-GENE-051101-1 wwtr1|OTTDARP00000036421 wwtr1-001 LG_none CU469387.8,CU468731.16 Danio rerio protein_coding KNOWN, 1782 bp
GGAGCCGCTCAGACTGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGGCTTGAGTTTACAAACTTTCAGAAACTCCGCG
ATCGGACGCAGGAGGAACAAAAAACTCTCCAAACTCCACG
CGGGACAACATGACAAACGCCTTTCTAGCTTTATGACAAC
TTTTCGACGACTTACAAACACTTTTCAACTCGGCTGAAAC
TACTTAAGGACGAAAAACAGGAAAAGTTCCTACAGGAATT
TTTTTTTCCATCGGCCATTTTAATCGAAGTTTGTTTTGAC
CATGAGCGGTAATCCTCTCCAGCCGATACCGGGCCACCAG
GTGATCCATGTCGCCAAAGACCTGGACACGGATCTGGAGG
CTCTTTTTAACTCGGTCATGAACCCGAAACCGAGCTCCTG
GAGGAACAAGGATATGCCGCAGTCTTTCTTCCAGGAGCCG
GACTCGGGCTCCCACTCCCGGCAGTCCAGCGCGGACTCCG
GTTCTCTCCCGCCGAGGGTCCACTTTCGCTCGCGCTCATC
TCCGGCGTCCCTACAGCTGCCGGCGGGCTCCGTGAGCGGC
CCGAGCCCCGGGAGACTCCACTCCCACACCCGGCACCAGT
CCTGCGATGTGGCCGAGGAGCTGCCGCTGCCCCCTGGGTG
GGAGATGGCCTTCACCCCCAACGGCCAGAAGTACTTTCTC
AATCACATTGAGAAGATCACCACATGGCACGACCCCAGGA
AGAGCATGACGCCCTCGGTGGCCCAGCTGAGCCTCCATAA
TCAGGTCTCCAACACCGCCAGCATCCAGCAGCGCTCCATG
GCCCTCTCTCAGCCCAACCTGGTGCTGAACCAGCAGGCGC
ACCAGCAGCAGCAGCAGCACCTCCAGCAGCAGCAGCAGCA
GGTCCCAGTGCAAGTCCCGGTGCAGGCCCCTCAGCAGCAG
AGCTCTCAGCCCATGATGAACCTGAGCGCGCAGCAGCACC
AGCAGAAGATGAGGCTCCAGCGCATCCAGATGGAGAGAGA
GCGCATCCAGAGGAGACAGGAGGAGCTCATGCGACAGGAG
GTGGCGCTCCGGCAGCTCCCCATGGACTCTGATAATCTGC
CGCCAGTGGCTCCAGCCATCGGCTCTCCAGCGATGAGTGC
GGGAAACATGCCCAATAACAGCGCAGACCCCTTCCTCAAC
AGTGGGCCGTATCACTCGCGGGAGCAGAGCACAGACAGTG
GACTAGGCCTGGGCTGTTACAGCATCCCGACCACTCCTGA
AGACTTCCTCAACAACATGGAGGACATGGACACAGGGGAA
AACATGGTTCCTGTGAGCATGAACGTCCCACCACAGAGCC
GCTTCCCAGACTTCCTGGACTCCATGCCGGGCACCAACGT
GGACCTGGGCACCCTGGAGGGTACAGACCTGATGCCCATC
CTCAACGACGTAGAGTCGGTCCTGAACAAGAGCGAGCCCT
TCCTCACCTGGCTCTAGACTCGCACACACTCACACACTAA
AGACTCTTTATATAAATATATCTATTATATTATATATTCA
ATCAGCCTCTTCCTCTAGTCTCACTACTTTAGCTGTCGGA
TTTGTGCTCTCAAAGTCAAAGAACAAAGCCAAAGTGTTTA
GCCTGTGAACAAATAAGCGAGCATTGGCCAATCAAACAGC
ACTGTGTGTTCATGTGTGTGTGTACTTGTTTATATATCTC
AGTGGGGACCTAAAGCTGAATGCACACAGACTCATGTGGA
CTTGTGTCACCGTGGGGACCAAAATTGAGGTAAACATGCT
TATAAATAAGACTGAATGAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations