ZFIN ID: ZDB-TSCRIPT-100915-1181
Transcript Name: twist2-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045977 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045977|OTTDARG00000032844|ZDB-GENE-980526-235 twist2|OTTDARP00000036279 twist2-001 LG_ CU929427.8 Danio rerio protein_coding KNOWN, 1227 bp
AAAAATTAGGAAAAAACTTCCTGCGGGAGGAAAACCGTGC
CAAGCTCTACTTCTGGAAGTAGGGGACGCGCGCAGTGTCA
GGACTTCAGGAGGACAGACAAAATCCCCAACAACAAAACG
GATATTACTAGTCTAAACCACGGAACCAAAAGTGGAGATC
GTATTTTCTCCTCGTTTCTTTAAAAAAGAAATGGAAGAGA
GTTCTAGCTCTCCCGTCTCCCCAGTGGACAGCCTGGTGAC
CAGCGAGGAGGAGCTGGACAGACAGCAGAAAAGGTTCGGG
AGGAAAAGGAGGCAAGGAAGGAAGTCGAGCGAGGACAGCA
GCAGCCCGAGCTCCGTCAATAAACGTAACAAAAAGCCGAG
CCCGAGCAGCACTCAGTCCTTCGAGGAGCTCCAGAACCAG
CGCGTCCTGGCGAACGTACGCGAGCGGCAACGGACTCAAT
CGCTGAACGAAGCCTTCGCGTCTTTGCGCAAAATCATCCC
CACGCTCCCCTCGGATAAACTCAGCAAGATCCAGACGCTC
AAACTCGCATCCAGGTACATTGATTTCCTCTGTCAGGTGC
TGCAGAGCGACGAGATGGACAACAAGATGTCCAGTTGCAG
CTACGTCGCGCACGAGAGACTCAGTTACGCGTTTTCAGTG
TGGAGGATGGAGGGCGCGTGGTCGATGTCTGCGTCCCACT
AGCAGCGAGACGCGTCCTGATAATGCCGAACGGACTGTTT
ACTTCCACTAATTTTGAAGATGCCAAAGGATTATTCGATG
AACCTCTAAACCTCAGTGACGTGGCCAAAGGACATTCAGT
GGATACATCTACGGACTTGAGCATCCTCATGAAGGACACA
ATAAAAGGGACTTTTTAATATACTTAGAGGAAAAGTAGAT
GACGTCTTCTGTGTCGTCAAATACATTTAATCTTTTTCAC
AAGTTATTCTTAAATGTCGCCATGATGATAGTACAGGAAG
GCTATCTGCTATCTGTATGGAAACTATATTTCATGTCTGT
CTCTAAACAGAAGAGTTTATATATATATAAGAACAAAAAA
AAAAAACTATTGTACATAGGCTACCTGCGAGTATTGTCAA
TTTTAAAGGGACCAATGCAATTATGAGCAATACTTTCTTG
AAGTACGCTGCATGGATAAATGCATACATTTGATTTTTCC
TATGCAACATTTTTCGATTTCCATCCAATGTTTATTTTGC
TTATTTATTAAAACATATTTTTGAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
twist2-001 Contained in:
OTHER twist2-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045977 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EF620931 (1) 1254bp
    GenBank:BC083313 (1) 1054bp
    CITATIONS (1)