Transcript

csnk2b-002

ID
ZDB-TSCRIPT-100915-1076
Name
csnk2b-002
Previous Names
  • ck2b-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044194 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044194|OTTDARG00000031721|ZDB-GENE-990415-29 csnk2b|no_translation ck2b-002 LG_none FP067441.5,FP017214.1 Danio rerio protein_coding KNOWN, 1914 bp
GTCGCTGCGGCTAACATCGACCCCGGGAGATCCTTGAGGT
AACATGAGTAGCTCAGAGGAAGTGTCGTGGATTTCTTGGT
TTTGTGGTCTACGGGGAAATGAATTCTTCTGTGAGGTGGA
TGAGGACTATATTCAGGACAAGTTTAATCTTACAGGACTC
AACGAGCAAGTTCCCCATTACAGACAAGCTCTGGACATGA
TCCTCGATCTGGAACCTGGTCAGTCATTTAGTTTTTCTAC
ACAATCCCACTTTTGTGCCATCATTATGGTCAGCATTTCT
TTTAAATAATTCAACCTTAAGCTTTAATTAAACGCATTAA
CGGCCCAACCTGTCACTTACATGAGACTAGCCAATAGCTA
AACCAGCATTCAGTCAATTGCCAATGGATGACGTCAAGTC
CTGCCAAATATTTCTTGTTCTTGTTGGAAAGCAGTGTCAT
GTGAATAGTGAGATGATTCTTGTGTTCATCAGATGAGGAG
CTGGAGGATAACCCTAACCAGAGTGACCTGATTGAGCAGG
CTGCTGAGATGCTCTATGGGCTGATTCATGCTCGCTATAT
CCTCACTAACCGTGGCATTGCCCAGATGCTGGAGAAATAT
CAGCAGGGAGACTTTGGCTACTGTCCTCGTGTTTACTGTG
AGAATCAGCCAATGCTGCCTATTGGCCTCTCTGACATTCC
CGGCGAGGCTATGGTGAAGCTCTACTGCCCCAAGTGTATG
GATGTGTACACGCCGAAGTCATCCAGGCACCATCACACTG
ACGGAGCTTACTTTGGCACCGGCTTCCCTCACATGCTCTT
TATGGTGCATCCCGAGTACCGGCCAAAAAGGCCTGCCAAC
CAGTTTGTGCCCAGGCTTTATGGTTTTAAGATTCACCCAA
TGGCTTACCAGCTCCAGCTGCAGGCAGCCTCCAGCTTCAA
GAGTCCCGTCAAAGCCATCCGCTAAACACCTGGGATGGGA
TGGGATGGGGTGGGGTGGGATGTCGGGTGGGTTGTGTGTC
CGTCAACAAGGGCTCACTCTTCTCCTTCGATTTGACCGAG
ACTAACATTTAAATGTGGAGAGAGTGAGACTGTAAAACAC
TGGGGAGAAACTAAAAGCTTACCTCTGAAACACTGTACAG
AAAATGAGGTGTTCCTTGTAAAAAAAACAAACTTCTTTCA
GTTCTCAACCTCCACATAGAAAATAAAGATCTACTTAAAG
ATAGATAACTGTAGGATGGCTCTGCTCGCTCTCTGGTTAC
TGTTTGTTTTAGTTTGCTAATGCTAACATATAAAACAGTC
TTGAATTGATGTCTTGTCAGTTCTCGGCATGGTGGATGGT
TGGCTTTGAATGTAAAAGTAGGGTTGATTGGTCATCAAAA
CCCCATTTAAATTGGCTCAATCCCCTTCTCTGATATTTGG
CTTATTGAAATAAAAAGGAAGGCTGTTGCATGATATATGC
AGTATGTTTTGGGTTTAAGTGACGTCGCTGGGATTGTCTT
TGACTGTTTTTTGTTGACAGACTGCAAGCTTTCACCGCAT
GCATAAGATAAGAGCAGAAATGGGAAGACAAGTGTAATCA
GGAAACGCCATCTTAATTCGACATGTTTTTGTTTTAATAT
TTGGTACTGCACTCTTCTTCAGATTGACGCCAACCTGCTG
CGTTCCTCCAGTGTCCAGATTCTTCAGACAAATTTGATTA
GATTGACCAGAGTTAGGATGTTTTTTATGTTTGGTATGGG
CCCAGGTTTTTCTTCTCTTGTTTAAAGTATTTCTTCTGGT
AGAGAAGAGTCAGAGTAGAAAATATAAAATGGGTTTAAAT
GCATTTCTTTTGTGTGTGCTATTTCTTTTCTTTGATCCTG
TTGAATGTTTTTTTTCCTTTACAGCTATTGAGGAACCAGG
GTTCAGAATTCACAATAAATGTCTTTTCCTACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations