header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-1076
Transcript Name: csnk2b-002
Previous Name: ck2b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044194 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044194|OTTDARG00000031721|ZDB-GENE-990415-29 csnk2b|no_translation ck2b-002 LG_none FP067441.5,FP017214.1 Danio rerio protein_coding KNOWN, 1914 bp
GTCGCTGCGGCTAACATCGACCCCGGGAGATCCTTGAGGT
AACATGAGTAGCTCAGAGGAAGTGTCGTGGATTTCTTGGT
TTTGTGGTCTACGGGGAAATGAATTCTTCTGTGAGGTGGA
TGAGGACTATATTCAGGACAAGTTTAATCTTACAGGACTC
AACGAGCAAGTTCCCCATTACAGACAAGCTCTGGACATGA
TCCTCGATCTGGAACCTGGTCAGTCATTTAGTTTTTCTAC
ACAATCCCACTTTTGTGCCATCATTATGGTCAGCATTTCT
TTTAAATAATTCAACCTTAAGCTTTAATTAAACGCATTAA
CGGCCCAACCTGTCACTTACATGAGACTAGCCAATAGCTA
AACCAGCATTCAGTCAATTGCCAATGGATGACGTCAAGTC
CTGCCAAATATTTCTTGTTCTTGTTGGAAAGCAGTGTCAT
GTGAATAGTGAGATGATTCTTGTGTTCATCAGATGAGGAG
CTGGAGGATAACCCTAACCAGAGTGACCTGATTGAGCAGG
CTGCTGAGATGCTCTATGGGCTGATTCATGCTCGCTATAT
CCTCACTAACCGTGGCATTGCCCAGATGCTGGAGAAATAT
CAGCAGGGAGACTTTGGCTACTGTCCTCGTGTTTACTGTG
AGAATCAGCCAATGCTGCCTATTGGCCTCTCTGACATTCC
CGGCGAGGCTATGGTGAAGCTCTACTGCCCCAAGTGTATG
GATGTGTACACGCCGAAGTCATCCAGGCACCATCACACTG
ACGGAGCTTACTTTGGCACCGGCTTCCCTCACATGCTCTT
TATGGTGCATCCCGAGTACCGGCCAAAAAGGCCTGCCAAC
CAGTTTGTGCCCAGGCTTTATGGTTTTAAGATTCACCCAA
TGGCTTACCAGCTCCAGCTGCAGGCAGCCTCCAGCTTCAA
GAGTCCCGTCAAAGCCATCCGCTAAACACCTGGGATGGGA
TGGGATGGGGTGGGGTGGGATGTCGGGTGGGTTGTGTGTC
CGTCAACAAGGGCTCACTCTTCTCCTTCGATTTGACCGAG
ACTAACATTTAAATGTGGAGAGAGTGAGACTGTAAAACAC
TGGGGAGAAACTAAAAGCTTACCTCTGAAACACTGTACAG
AAAATGAGGTGTTCCTTGTAAAAAAAACAAACTTCTTTCA
GTTCTCAACCTCCACATAGAAAATAAAGATCTACTTAAAG
ATAGATAACTGTAGGATGGCTCTGCTCGCTCTCTGGTTAC
TGTTTGTTTTAGTTTGCTAATGCTAACATATAAAACAGTC
TTGAATTGATGTCTTGTCAGTTCTCGGCATGGTGGATGGT
TGGCTTTGAATGTAAAAGTAGGGTTGATTGGTCATCAAAA
CCCCATTTAAATTGGCTCAATCCCCTTCTCTGATATTTGG
CTTATTGAAATAAAAAGGAAGGCTGTTGCATGATATATGC
AGTATGTTTTGGGTTTAAGTGACGTCGCTGGGATTGTCTT
TGACTGTTTTTTGTTGACAGACTGCAAGCTTTCACCGCAT
GCATAAGATAAGAGCAGAAATGGGAAGACAAGTGTAATCA
GGAAACGCCATCTTAATTCGACATGTTTTTGTTTTAATAT
TTGGTACTGCACTCTTCTTCAGATTGACGCCAACCTGCTG
CGTTCCTCCAGTGTCCAGATTCTTCAGACAAATTTGATTA
GATTGACCAGAGTTAGGATGTTTTTTATGTTTGGTATGGG
CCCAGGTTTTTCTTCTCTTGTTTAAAGTATTTCTTCTGGT
AGAGAAGAGTCAGAGTAGAAAATATAAAATGGGTTTAAAT
GCATTTCTTTTGTGTGTGCTATTTCTTTTCTTTGATCCTG
TTGAATGTTTTTTTTCCTTTACAGCTATTGAGGAACCAGG
GTTCAGAATTCACAATAAATGTCTTTTCCTACAA

csnk2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA csnk2b-002 1914
csnk2b-003 (1) 768
mRNA csnk2b-201 (1) 1659
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csnk2b-002 Contained in:
[Fosmid] CH1073-121K17 (1) (order this)

OTHER csnk2b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044194 (1)
  • Ensembl_Trans:ENSDART00000145729 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC059698 (1) 1943bp
    GenBank:BG738970 (1) 407bp
    CITATIONS (2)