header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-100915-47
Transcript Name: csnk2b-003
Previous Name: ck2b-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044195 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044195|OTTDARG00000031721|ZDB-GENE-990415-29 csnk2b|no_translation ck2b-003 LG_none FP067441.5,FP017214.1 Danio rerio protein_coding KNOWN, 768 bp
GCTGCGGCTAACATCGACCCCGGGAGATCCTTGAGGTAAC
TTTCCCAACATGAGTAGCTCAGAGGAAGTGTCGTGGATTT
CTTGGTTTTGTGGTCTACGGGGAAATGAATTCTTCTGTGA
GGTGGATGAGGACTATATTCAGGACAAGTTTAATCTTACA
GGACTCAACGAGCAAGTTCCCCATTACAGACAAGCTCTGG
ACATGATCCTCGATCTGGAACCTGATGAGGAGCTGGAGGA
TAACCCTAACCAGAGTGACCTGATTGAGCAGGCTGCTGAG
ATGCTCTATGGGCTGATTCATGCTCGCTATATCCTCACTA
ACCGTGGCATTGCCCAGATGCTGGAGAAATATCAGCAGGG
AGACTTTGGCTACTGTCCTCGTGTTTACTGTGAGAATCAG
CCAATGCTGCCTATTGGTGAGTGCCTCAGCCTGTTTTGTG
CATGTTATTTTACCAACCCAGTTTTCATGTAGTAGAAAAA
TGTATAAGGTAAAAGTATTTGCAGTAGTTGCATATTGACA
TACAATTATTTAGTTGATTAAATATAACCATTTAAACGAC
ACATTAATATTAATAAAAATAATAAAGAATATGTATCATT
TGATTGAGCACTGTAGGCTCTGTCTTTAAAAGTTTTATGT
AGGTCTATCCTTATATACAGTTAAAAACAAGTCATATTTT
AAAATATTGGCACAAAAATCTGTACTTGTTTTTAATTTGT
CATTTATTTATTTATTTTAAATGTATTTTTTATTTAAAAA
TAAATGTT

csnk2b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA csnk2b-002 (1) 1914
csnk2b-003 768
mRNA csnk2b-201 (1) 1659
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csnk2b-003 Contained in:
[Fosmid] CH1073-121K17 (1) (order this)

OTHER csnk2b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044195 (1)
  • Ensembl_Trans:ENSDART00000144040 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT727003 (1) 766 bp
    CITATIONS (2)