ZFIN ID: ZDB-TSCRIPT-100909-1
Transcript Name: si:ch1073-228j22.3-001
Previous Name: ch1073-228j22.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
ZFINNUCL0000002323 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>lcl|ZFINNUCL0000002323|ZDB-TSCRIPT-100909-1 unreleasedRNA ch1073-228j22.3-001 mRNA 1281 bp
ATGAGCGGCGGCGTGTACGGCGGAGATGAAGTGGGCGCGC
TGGTGTTTGACATCGGCTCTTTCTCCACCAGAGCAGGATA
CGCTGGAGAGGACTGTCCCAAGGCGGATTTTCCCACCACT
ATAGGAGTGAACGCCGAGGAGGAGGGGCCAGCGGACATGG
GGGTGGAGCAAGAGAGCAACAGTGGGCGGAGCTACTACAT
TGACACCACAGCTCTGCATGTGCCTCGGGCAGGAGTAGAG
CTGATCTCTCCACTGAAGAACGGCATGATTGAGGACTGGG
ATGCTTTCCAAGCCATAATCGACCACATCTACAGCAAACA
CATCAAATCAGAGCCCGGTTTACACCCCGTCCTGATGTCT
GAAGCTCCTTGGAACTCGCGAGCCAAGAGGGAAAAACTCA
CAGAGCTCATATTTGAGCATTACAACATCCCCGCTTTCTT
CCTGTGCAAAACAGCCGTGCTCACCGCCTTCGCCAACGGT
CGAGCCACGGGCCTGGTGCTGGACAGCGGAGCCACGCACA
CCACCGCCATCCCTGTGCATGATGGGTACGTCCTGCAGCA
AGGGATCGTGAAGTCTCCTCTGGCCGGGGACTTCATCAGC
ATGCAGTGTCGAGAGTTGTTTCAGGAGATGAACATCGACA
CCGTTCCTTCATACATGATCGCGTCAAAGGAGCCCGTGAG
GGAAGGAGCTCCGGCGATGTGGACAAAGAAAGACAAACTG
CCTCCAGTCAGCAAGTCGTGGCACACGTTTATGTGTAATG
AGGTGATCCAGGACTTCCAGGCGTCTGTGCTGCAGGTGTC
TGACTCTCCGTACGATGAACAGGTGGCTGCTCAGATGCCA
ACAGTGCATTACGAGATGCCGAGCGGATACAGCACAGATT
TTGGAGCGGAGCGTTTGCGGATACCGGAGGGTTTGTTTGA
TCCATCTAATGTGAAGGGATTGTCCGGTAACACCATGCTG
GGTGTCGGACACGTGGTCACCACCAGCATCGGCATGTGTG
ACATCGATATCAGACCGGGTCTGTACGGAAGTGTGATCGT
GACAGGAGGAAACACACTTCTGCAGGGCTTCACAGAAAGA
CTCAACAGAGAACTGTCTCAAAAAGCACCACCGAGCATGA
GACTGAAGCTCATCGCCTGTAACAGCTCCATAGAGAGGAG
ATTCAGCTCCTGGATTGGAGGATCTATTCTAGCTTCACTG
GGAACCTTCCAGCAGATGTGGATCTCGAAGCAGGAGTATG
ATGAGGGCGGAAAACAGAGTGTGGAAAGGAAATGCCCCTA
A

actl6b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actl6b-202 (1)    Ensembl 1592
si:ch1073-228j22.3-001 1281
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch1073-228j22.3-001 Contained in:
[Fosmid] CH1073-228J22 (1)

Genome Resources:
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)