header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-338
Transcript Name: pdk1-201
Previous Names: pdk1-001, si:zfos-979f1.3-001, zfos-979f1.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045847 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045847|OTTDARG00000032763|ZDB-GENE-091204-402 pdk1|OTTDARP00000036178 ZFOS-979F1.3-001 LG_ FP236594.5 Danio rerio protein_coding NOVEL, 1684 bp
CACGAGTCAGCTTGTTTACAGCAGTCTGACGGACCAGACA
GATAACCAAGCGAGGAAACACCTCAAAGATTACGGCTTTC
TATAGTGTTTAGCGTCCTCGGGGCTCAGCAAGTGTTATTT
ATAGGCTTCATCGCAGTGTTTATGTGAACGCGGCCCAGTG
TTCACTGATGCTCCTGCGGTTCATATGAGTTCACACACAC
ATACACACATCACTGCAGGATTACCCGCGTGTCTTGAAGG
TTATATTATTAATGTCATGACTGCAGTGGCTTTATTGGGT
GACAAAGAAGATTGAATATCTTCCTGTGAGGACATGACTG
ACAGTCAACTTTATGCTACGAGAAACGTCTAACGTACACA
ATTCTCTGCTGTTTTTAATACTCGGACGAGAAAATGCGCT
CAGAAACACTACAGGACTCTGATTTCTGGATTTTCTGAAG
AATTAAACCGCAAAAAGACGCCAACATGAGGATCTTCAGG
ACTTTACTGAACGCAGCGTCCAAGCAAATCGACTTCTACT
CCAGATTCTCTCCTTCTCCTCTGTCTATGAAGCAGTTCAT
AGATTTTGGTTCGGAGAACGCCTGTGAGAAAACGTCATTT
ACATTCTTAAGGCAGGAGCTGCCCGTCAGGCTGGCGAATA
TAATGAAAGAAATCGACTTGCTTCCTGACAACCTTCTGAG
AACTCCTTCAGTGCGGCTGGTGCAGAGCTGGTACATGCAA
AGTTTTCAGGATATACTGGAATTCAAGGACAAGGATGCTG
ACGATGAAACAGTCAATCATGATTTCACAGATGCTGTGAT
TAAGATCAGAAACCGCCACAATGATGTGGTGCCCACCATG
GCTCAGGGTGTTGTGGAATACAAGGAGACCTACGGCACTG
ACCCCATCACCAGTCAGAATATGCAGTACTTTCTGGACCG
TTTCTACATGAGCAGGATTTCAATCAGAATGCTCCTGAAC
CAGCACACTCTTCTGTTCGGAGGAAAGGTGAGGGACAATC
CTGCTCATCCCAAACAGATCGGCAGCATTGACCCCAGCTG
TCGGGTCACGGATGTGGTAAAAGATGCTTATGAAAATGCC
CGAAACCTGTGTGACCGGTATTATATGAACTCGCCCGAGC
TAGTGTTGGAGGAATTTAATGTTAAAGGACCAGATAAACC
CGTTACTGTGGTTTATGTACCATCTCATCTCTACCACATG
GTGTTTGAGCTCTTTAAGAATGCCATGCGCGCTACCATGG
AGCTTTATGAAGATGCCATGGAGTATCCCCCAGTGCATGT
GCAGATCGTCCTCGGCCATGAAGACTTGACTGTTAAGGTC
AGTGATCGAGGAGGCGGAGTCCCGCTGAGGAAGATTGACA
GGTTGTTTACATACACCTACTCCACAGCCCCTCGTCCTCA
GATGGACACATCTCGAGCCACTCCACTGGCTGGTTATGGT
TATGGGCTGCCCATCTCCAGACTTTATGCCAGATATTTCC
AGGGTGACCTGAAACTTTATTCTATGGAGGGATTTGGCAC
AGATGCTGTTATTTACATCCGAGCTTTGTCCACCGACTCC
ATCGAGAGGCTTCCAGTTTACAACAAATCAGCCTGGAAAC
ATTATAAGACCATCCACGAGGCTGATGACTGGTGTGTGCC
CAGCAAAGAGCCCAAAGACATGACCACCTTCCGCAGCTTC
TAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdk1-201 Contained in:
[Fosmid] ZFOS-979F1 (1)

OTHER pdk1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045847 (1)
  • Ensembl_Trans:ENSDART00000020861 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN327936 (1) 905bp
    GenBank:EE331587 (1) 877bp
    GenBank:CN511131 (1) 848bp
    CITATIONS (2)