header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-334
Transcript Name: hmha1b-202
Previous Names: hmha-1-001, hmha1-001, hmha1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045834 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045834|OTTDARG00000032755|ZDB-GENE-071213-2 hmha1b|OTTDARP00000036166 hmha-1-001 LG_ CU695074.11 Danio rerio protein_coding KNOWN, 2728 bp
GCGATGAGCGCTGAAGAGGTGGACATCATCCTGCAGCGCA
GTGAAGGCGGTGTGGACTCCGCTCTGACGTACGCTAAAAC
CATCTCCAAATACTTGAAGGATCTCATCGGATACGTAGAG
AGGAAGCTTGCGCTGGAGCTGGAGTTCTCCAAGGGTTTAC
AGAGGATCTATCAGTCGTGTAAACAGACCATCACACAGCC
ACACATGCCCTTCTTCACCATCTACTCTCAGGCACTGGAG
CAGGATCTGGAGCAGAGCAATGGCATGCATCAGGCTGCCG
CAACTCTACAGAACCAGACCTTTATCATGCCTCTGATGGT
CCGCAAACAAGAGCATGAGAAGAAACGCAAAGAGATCAAG
GAGCAGTGGCTGAAGGCCAAAAGAAAACTGATGGAGTGTG
ACGTGAACCTACGCAGGGCTAAACAGGTCTACATGACCCG
CTGTGAAGAATATGATAAAGCCAGGACAGCGGCGAACAGG
GCCGAGGAGGAGGGCGGCAGTGCCACCACCAAAACACTGG
ACAAGAAGAAACGACTGGAGGAAGAGGCCAGAAACAAGGC
TGAGGAAGCGGAGGCCACATACCGGACCTGCATTGCAGAC
GCTATCACTCAACACCAGGAGCTAGAGCACATGAAAGTCA
CTGTCCTGCGGGGGATTCAAGAGGTCATCAAGCAGACCGA
CCAGACCATTCGATCTGCCACCATCTCCTACTACCAGATC
ATGCACATGCAGACGGTCGCGCTGCCGGTCCACTACCAGA
CTCTGTGCGAGAGCAGTAAACAGTACGACCCGGGACAGCA
GTACGGCACGCACGTCAAAGACCTTCAGATGAGCGAAGAA
CCTGAAACGCATTATGAGTTTGAGGCCTACTCTGCCTCCT
CTGTCCAGCAGTCGGTTAGGCCGCGCACCGACAGCGCTAA
TGCTGAAGCTCAGAGCAGTGCTGAGGTGCCACAAACTGCA
GGAGAGACTGGAGACACGAGCAGCTCACAGAAAGATGATC
AGAAGAGGGCTCGAGGTCACATGACTCACAAATCCTGGGG
CTCCACAGTGAGTGACACAGACAGTGTAGGAGGAGGAAGT
GGCCTGGAATCCCCGACTACCAGCACAGGTGATATTAGTA
AAATGACCAGGACGTCATCTACAGGAACCATGTCATCAAA
TGAAGATATAGATGAGAAAGACGCAAATGTTACTTCCTTT
GAAACGCCAAATATAAATGGCATTGAGCCTGAGATTGTGG
TGCCCACTGGGCCCTTCAGGAACATTGGCTTGTCAAAAGC
CGCTCAGACGCACAAACTGCGTAAACTGCGCTCTCCATCC
AAATGCAGAGAATGTGACAGCTACGTTTATTTCCAGGGAG
CCGAGTGTGAGGAGTGTTTCCTGGCTTGTCACAAACGCTG
CTTGGAGACTATAGCCATTCAGTGCGGCCACAAGAAGCTC
CAGGGCCGCCTTCAGCTGTTCGGGCAGGATTTCTTGCAGG
TGTCCAGCAACAGTCCCGATGGGATCCCCTTCATAATCAA
GAAGTGCATCGCTGAGATAGAGAGACGAGCTTTAAGGATG
AAGGGCATTTATCGAGTGAATGGAGTAAAGACGCGGGTGG
AGAAACTCTGCCAGGCATTTGAGAACGGCAAAGAGCTGGT
CGAACTATCACAGTCATCTCCACATGACATCAGTAATGTC
CTGAAGCTTTACCTGCGACAGCTTCCGGAGCCCATCATGC
CCTTCCGCCTCTACAACAGTCTCATGGGTCTGGCCAAGGA
AAGTCTGGCTGTTGTGGGTCCAGAGGGAGCTGACAGTGGT
AAAGGACCAGACCTGATGGACCTTGGACCTGAGACGGATC
CTGAACTCTTGGTCCTCGTGGACAGACTTAAAAATCTCCT
GAAAGAGCTGCCCAAACCAAACACCGCCACGCTCCGCTAC
CTAGCGCGTCATCTGAGGAGGATTGCAGAACTGGAAGACG
ACAATAAGATGAGTCCCAGTAATCTGGGGATCGTGTTTGG
CCCGTCACTGATGCGGCCCCGGCCCTCGGGAGCCACAGTG
TCTCTGTCCTCTCTGGTGGATTACCCATATCAGGCCCGCA
TAGTGGAGACCCTCATCGTGTTTTATCCCTCCATTTTTCA
GTCAGAGTCCAGTCGGCCTGCAAGCAGCAGCACCCGCACA
CAGTCTCTACAGCAGCAGAGCAGCATTGATGAAGAACGCT
GCTCTAATGATGAACAAGGCCTCCCAGATGAACCTGCAGC
TGTTGAATTAGACAAGCTGGAGGACCACGAGAGTTGTACA
GGAACCCCAGACTCTCTGGAGCACAGTCTGGACTTGGATT
CAGACCCAGAGGCAGAGCAGCCTGTTGATGAAACGTCTAT
CCAAAGCAGGCCAGCGGTACTCCTGGTGACCCTGCAGAGC
TCCAGCGCTGACCCTCCTGCCCTCCCTGAGAGCGAACCAC
CAGAGCTGGAGGACCAGAGCCACTCACTAGCGGCCCTCAA
CATCAACCAGAGTAACAACACCACCAAAACACTCACCTCT
TGAGCCCATCCGTCAAACCTTTGTGTTTTTATAGACCACT
TTTAATATTTAACAGCCTTATAATCTTGGTTCATTTTAAA
TCTCTTCAGCTTTTATTTTTTTGCCAAACAGTGATCCGGG
CATCATCATCCCATCATGCATTGTATGTTTTGAGGTTTTA
TGCTTGTCTTTTAATATTAATAATAATAAAAAACAAATGA
TTTACAAA

arhgap45b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hmha1b-202 2728
si:ch73-243b8.4-201 (1)    Ensembl 1483
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hmha1b-202 Contained in:
[BAC] CH73-243B8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000045834 (1),  Ensembl_Trans:ENSDART00000132565 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC134232 (1) 1486 bp
GenBank:EG571860 (1) 973 bp
GenBank:EG585114 (1) 933 bp
GenBank:CF266080 (1) 914 bp
GenBank:EG584987 (1) 910 bp
GenBank:DT871508 (1) 851 bp
GenBank:CK026464 (1) 769 bp
GenBank:AW306083 (1) 642 bp
GenBank:EB929905 (1) 383 bp
CITATIONS (2)