ZFIN ID: ZDB-TSCRIPT-091203-216
Transcript Name: si:ch73-243b8.4-201
Previous Names: ch73-243b8.4-001, si:ch73-243b8.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045821 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045821|OTTDARG00000032749|ZDB-GENE-091204-453 si:ch73-243b8.4|OTTDARP00000036157 CH73-243B8.4-001 LG_ CU695074.11 Danio rerio protein_coding NOVEL, 1483 bp
TGTGCACTGTGTGGCAGACAGCGAATCTTGTTTTTACGCG
CAAGAAAATGATGTGAATCCCCTCATGTACGTTGCTTTAA
GTTTCAGCGAGAATGTATGAAGCTATCCAGCCCACATGTT
TCTTCACGGCAGCGCAGTTTCACTTGTCAAAAGCACAGCG
AGAGAGAAAAAACAGAAAAGCGGATGCGCCTGATGTGTGT
CAGTAGACTCGCTCAATGTGCGATGATCGTTTTGTTCGAG
TGAGACTGAAGCTCCAGCTCGCACTGCGCAAACCTCGCAT
CAGCGCTTTGACATGGGGAGCCGGGGGGTGGGCAGGGGGC
TTGCAGAGTAAATATAACGAATTACGAGTCCGGTACTAAC
ACCTGAAGCTTAAGATGTTCTCCAAAAAGACGAGGGAACT
AATAAAGACGCACTCGATGTCTAAGAAGAGCCGAACAGGA
AGCAGCAACCCAGCGCCTCTCAGCTCTCCATCACTGTCCG
CTCTTCAAGAACAGCCTAGGAAAGATGCAGTGGACAGTGT
CACCTCTTCATCCCAAACGTCCTCCAGTCTGTCTCCCCCT
ATCGTAGAGGTCTCGTCGTCCTGTCCAGGTACGCCTTTGA
CCCAGCACTCAAAGGCGCTGGGCTGCCCATCTCCGATGGG
CACCCTGAAGCGGCCCACTTCTCTGAGTCGCAATCCCAGC
GCTGCCGGCTTCCCCATCCAATCTTGGGTGTTCAGTAAGG
GTGCAGGAAAATCCGTCATTGCCCAGAGCCCTTCACCAGA
GACAGCTGACACCACAGTGGCCATCGAGGTGGAGGACATC
CCGTCCCTGCTGCGCAGTGTGGAACGCTTTGCCAAAGCGG
TGGAGAAACTAAAGGATGTCGTGCTTGAAGATAAGCAGGA
GAACCGACGTCCGCTGGCTCACGAGTGTCTGGGTGAAGTG
CTGCGGGTCCTGCGGCAGGTCATCAGCATGTACCCACTGC
TCAACACCGTGGAGACGCTCACCGCTGCTGGAAAACTCAT
CTCACAGGTCAAAGGTTATCACTATGAATCGTGCATTGAA
CCAGAAAAGAAGGATTTTGAGAAGGCCATTGAGACAATCG
CTGTGGCTTTCAGCAGCAATGTTTCGGAGCTGCTGATGGG
AGAGGTGGACAGTAGTACACTGTTGTCAGTGGTGCCCACT
GAGAAAAGCAGGTCTATGGAGAATCTCTCTGGTCATGGGT
CTTCACACACATGGGGTGATTCATCTGAGCTGGGTACTTT
TTTTTTTTGATTATTACTATTATTATTAATTTAAGATATT
CTTTAACTTATTTAAAATGATTACAGCAAATTATAAGAAT
ATTAATAATTTAAAATATTCTTTAATCTATTTAGAGTAAT
TAAATTATAAGAATAGCTTTTGACATTGTTATTATTATTA
TTATTATTATTTAAATTATTATTATTGTTGTTGTTGTTGT
TGTTGTTTAAAATATTTTTTATTATTAATTAACAATTTTC
TTT

arhgap45b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hmha1b-202 (1)    Ensembl 2728
si:ch73-243b8.4-201 1483
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-243b8.4-201 Contained in:
[BAC] CH73-243B8 (1)

Genome Resources: Vega_Trans:OTTDART00000045821 (1),  Ensembl_Trans:ENSDART00000138483 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DT066075 (1) 809 bp
GenBank:CN323074 (1) 767 bp
GenBank:BM101923 (1) 662 bp
GenBank:AW133733 (1) 636 bp
CITATIONS (2)