Transcript

kcnip3a-001

ID
ZDB-TSCRIPT-091203-258
Name
kcnip3a-001
Previous Names
  • ch73-305k12.1-001
  • kcnip3l-001
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045565 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045565|OTTDARG00000032596|ZDB-GENE-040426-1791 kcnip3a|no_translation CH73-305K12.1-001 LG_none CU915779.6,FP340259.6,CU914617.7 Danio rerio processed_transcript NOVEL, 1309 bp
CGGAGAAGCTGCTGCTCCTGGAGAGAGTGGAAGAAACGCG
TTTCTCCTCAGCGCTTGAGGAGGATTCATCACGAGACACA
ATGCAGGAGGATGGCAAGGTGGTGGACGGCACTCTGCTGG
GTGATGCCAATGGGGTGGAGCCTGGCAGAGGCCGACAGAA
GGAAAGTGGCAAATGGCAGAGACCTCGCTTCACACGGAAA
GCCCTCATGAGGTGCTGTCTGGTCAAATGGATCATCGCCA
GCACTGGACCCAAGGAGCAAGAGACAGCAGTGACAGTGAC
CTTGAGCTGTCCACGGTGCGGCATCAGCCCGAGGGTCTGG
AGCAGTTGCAGGCACAGACCAAATTCACCAAGAAGGAGCT
GCAGTCCCTATATAGGGGCTTTAAAAATGAGTGCCCAAGT
GGTTTGGTTGATGAGGAAACTTTCAAGACCATCTACTCCC
AATTCTTTCCCCAAGGCGATGCCACCACATACGCCCATTT
TCTGTTTAACGCATTTGATCTTGACAGAAATGGCTCGATC
CGTTTTGAGGATTTTGTGATTGGTCTGTCCGTGTTGCTGA
GAGGAACAGTCACTGAAAAGCTCAACTGGGCTTTCAACCT
TTACGACATCAACAAGGATGGATACATCACTAAAGAGGAG
ATGCTGTTAATTATGAAGTCAATCTACGACATGATGGGAA
GGTACACATACCCCAGTGTGCGAGACGAAGCTCCATCTGA
ACATGTGGAAAAGTTCTTTCAGAAAATGGACAGAAATCGA
GACGGTGTGGTCACTATTGAAGAGTTTATTGAGACCTGTC
AGAAAGATGAAAACATCATGAACTCCATGCAGCTCTTTGA
AAATGTGATATAGCCCGAAAATGGATCACGGTAAAGCTGA
AACAGCCGTCAACGTCCTAAAACCAGATCTCTCTATCTGT
CTATATACCAAACTAGCACAGCAGTCACTCTCTGTTTTGT
CCTGTAGCACTAATCCCATGCCTGCTGCACTCTGTAGAAA
ACTATAGACCAACACTTAGCCTGCAATATGGCGTCACAAT
TTATACTTCACAGCGGGACTACTAGCCAAGCAAAAAAAAA
AAGAAGAAGAGCCAGGATGGCTGGGATCCTTCCAGTTGCT
AAATACAAGCAACAAAACAATGAAACTTTTAAACCGAATG
AACAAACCAAGTAGCAAAGCCACGTTTTGTATATCAGGTT
GATGGATTCCCATGGAGTCGCCCACTTCCACATGAAAATC
ATCACCATTCTGGACTGCTGTCTTCTGCCTTATGAATGAG
GGACATTACAAGACTCGATCTCAACCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations