ZFIN ID: ZDB-TSCRIPT-091203-242
Transcript Name: myo7aa-001
Previous Name: myo7a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045280 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045280|OTTDARG00000032417|ZDB-GENE-020709-1 myo7aa|OTTDARP00000035783 myo7a-001 LG_ CU459145.21 Danio rerio protein_coding KNOWN, 7447 bp
GGGTCTGGTGTGAGACGTCTGATGTCCGGGAGGAAACACA
CACACCATGGTCATACTGCAGCAGGGGGATTATGTCTGGC
TGGACCTGAAGACGGGTCATGAGTTTGAGGTCCCGATCGG
AGCTGTGGTGAAGCTCTGTGATTCTGGACAGATTCAAGTT
CTGGATGATGAAGGAAATGAACACTGGATCTCTCCTCAAA
ATGCCACCAACATCAAGCCGATGCACCCGACCTCCATTCA
CGGTGTGGAAGACATGATCCGGCTGGGGGATCTGAACGAG
GCGGGAATCCTCCGAAATCTGCTCATCCGATACAGAGAAC
ACCTCATCTATACGTATACGGGGTCCATCTTAGTGGCCGT
CAACCCGTATCAGCTGCTTCCCATTTACACAGCAGACCAG
ATTCGCCTTTACACCAATAAAAAGATTGGAGAAATGCCTC
CACACATCTTCGCCATCGCAGACAACTGCTATTTCAACAT
GCAGCGCAACAACAAAGACCAGTGCTGCATCATCAGTGGT
GAATCTGGTGCTGGAAAGACAGAAAGCACCAAACTGATCC
TGCAGTTTCTGGCAGCCATCAGCGGGCAGCACTCCTGGAT
CGAGCAGCAGGTGCTGGAGGCAAATCCCATCCTGGAAGCC
TTTGGAAATGCTAAAACCATCCGAAACGACAACTCAAGCC
GCTTTGGGAAGTACATCGACATCCACTTCAACAAAAGAGG
AGCCATAGAGGGAGCAAAGATCGAACAGTACCTTCTGGAG
AAATCCAGAGTGTGTCGACAGGCCCGTGATGAGAGAAACT
ACCACATTTTCTACTGTATGCTGAAGGGAATGACTCCAGA
CCAGAAGAAGCAGCTGGGTTTGAGTAAAGCCACAGACTAC
ACTTACCTCACTATAGGGAACTGCACTGTTTGTGACGGTC
GAGATGATCAGAAGGAATACTCTAACATCAGATCAGCCAT
GAAGGTGCTCATGTTCACAGATAAGGAGAACTGGGAGATC
TCCAAGCTGCTGGCTGCTATTCTGCACATGGGCAACCTCC
GCTACGAGGCCCGCACATATGATAACCTGGACGCCTGTGA
GGTGGTGCGCTGCTCAGCTCTCACCACCGCTGCTGTTTTA
CTAGAGGTGGACTTGAAGGATCTGATGAACTGTTTGACCA
GCCGAACTATAATAACCCGTGGAGAGACGGTGTCTACTCC
GCTCAGCATTGAACAGGCATTGGACGTGAGAGACGCTTTT
GTTAAGGGCATTTATGGCCGTTTGTTTGTGTGGATTGTTG
AGAAAATCAACGCAGCCATTTATAAACCTCCATCTCTGGA
GCTGAAAGCAGTGCGAAGATCCATCGGCCTATTAGATATC
TTCGGCTTCGAGAACTTCATGGTTAACAGCTTTGAGCAGC
TGTGCATTAACTTTGCCAATGAAAACCTGCAGCAGTTTTT
CGTCCGTCATGTGTTCAAGCTGGAGCAGGAGGAATATAAC
CTGGAGAACATCAACTGGCAGCACATCGAGTTCACAGACA
ACCAGGACGCTTTAGACATGATCGCCATAAAGCCCATGAA
CATCATCTCGCTCATCGACGAGGAGAGCAAGTTTCCAAAG
GGCACAGACACCACCATGCTGAACAAACTCAACTCTCAAC
ACAAGCTCAACACAAACTACATCCCACCCAAAAACACCTA
TGAAACACAGTTCGGCATCCAGCACTTTGCTGGAGTGGTG
TACTACGAGACCAGAGGTTTTCTGGAGAAGAATCGAGACA
CTCTGCATGGTGACATCATTCAGCTCGTTCACTCCTCCAA
AAACAAGTTCATCAAGCAGATCTTTCAGGCGGATGTCGCT
ATGGGAGCAGAGACCCGCAAGCGTTCTCCGACTCTGAGCA
GTCAGTTCAAGCGTTCTCTGGAGCTGTTAATGCGCACACT
GAGCGTCTGCCAGCCGTTCTTCGTCCGCTGCATCAAACCC
AATGAATACAAGAAACCCATGCTCTTTGATCGTGAGCTGT
GTGTGCGGCAGCTCCGTTATTCTGGCATGATGGAGACCAT
CCGGATTCGCCGGGCCGGATACCCCATTCGATACACGTTT
GTGGAGTTTGTGGACCGGTACCGTGTTTTAATGCCTGGAG
TGAAACCTGCTTACAAACAGGAGGACCTGAGAGGAACCTG
TCAGCGTATTGCTGAAGCTGTATTGGGCCGTGATGATGAC
TGGCAGATGGGGAAAACTAAAATATTCCTCAAGGACCATC
ATGACATGCTGCTGGAGATTGAAAGGGATAAGGCCATTAC
TGATAAGGTCATTCTCATTCAGAAAGTTGTACGAGGATTC
AAGGACAGATCCAACTTCCTGAAGATGAAGAAATCAGCTA
TGCTAATCCAGAAGACATGGCGAGGTTATTACTGCCGGAA
GAACTACGGAGCGATGCGTGGCGGTTTCTCACGTCTGCAG
GCGCTATATAGATCTCGCAAACTCTACCAGACGTATCATG
TGGCACGGCAGAGAATCATGCTCTTCCAGGGCCGATGCAG
AGGTTTTCTGGTGCGCAGAGCGTTTCGCCACCGCCTGTGG
GCTGTGATCACAATCCAGGCATATACGAGAGGAATGATCG
CCCGCCGGCTCTACAAACGACTCAAAGGAGAGTACCGGCG
ACGTTTGGAGGCCGAAAAGTTGCGTCTGGCCGAAGAGCAG
AAGCTCAGGAATCAAATGAGCGCCAGAAAAGCCAAAGAAG
AAGCTGAAAAGATGCATCAGGAGAGATTGGCACAGCTGGC
GCGAGAAGACGCCGAACGGGAGAAGAAGGAGCGGCAGGAG
GCTCGCAGGAAAATGGAGATGTTGGACCAGATGGAGAAAG
CCAGACAGGAGCCAGTCAACGATTCTGATATGGTGGACAA
GATGTTCGGCTTCCTGGGAACCACAAACTCTTTCCCTGGT
CAGGAAGGTCAAGCGCCTGCTGGGTTTGAGGATCTGGAGC
GAACACACCGGGAGCTGGAGGTGGAGGATCTAGACGAGTC
TCTTCCACTCCCGGAGGACGATCTGGAGGACCTGTCCGAG
TACAAATTCGCCAAGTTTTCTGCCACATATTTCCAGGGCA
CGAGCACACACACGTACATGAGGCGGCCATTAAAACAGCC
ATTACTGTTTCATGAGGATGAAGGAGATCAGCTGGCGGCT
CTGGCCGTGTGGATCACCGTCCTGCGCTTCATGGGTGACC
TTCCCGAACCCAAATACCACACGGCCATCAGCGACGGCAG
CGAGAAGATCCCTGTCATGACCAAAATCTACGAGACACTC
GGAAAGAAAACCTACAAGAGGGAACTGCAGGCACTGCAGG
GAGAAGGAGAGAACACTAACATTGAGAGTCACAAGAAGAG
CAGCGTGCGGCACAAACTGGTGTCGCTCACCCTGAAGAAG
AAGTCTAAAATTACAGAGGAGGTAACCAAGCGTTTAAATG
ACGGGGAATACACTGTTCATGGAAACAGCATGTTGGAGGA
TCGACCCACGTCCAATCTGGAGAAACTGCACTTTATCATC
GGCAACGGCATCCTGCGTCCAGGCCTGAGAGATGAGATCT
ACTGTCAGATCTGTAAACAGCTGAACCAGAATCCGTCTAA
AAGCAGTCACGCTCGCGGCTGGATCCTCATGTCTCTGTGC
GTCGGCTGCTTTGCTCCCTCTGAGAAGTTTGTCAAGTATC
TGAGGAACTTCATCAGTGAAGGTCCACCAGGTTACGCTCC
TTACTGTGAGGAGAGACTGAGGAGAACGTTTGTGAATGGA
ACAAGAACACAGCCGCCGTCCTGGCTCGAGCTTCAGGCCA
CAAAATCGAAGAAGCCCATAATGCTGCCGGTGACTTTTAT
GGATGGCACAACGAAAACTCTGCTGACAGACTCTGCCACT
ACAGCTAAAGAGCTCTGCAATGCTCTGTCTGACAAGATCA
GCCTTCAGGACCGCTTCGGCTTCTCCCTCTACATCGCACT
CTTTGATAAGGTTTCGTCTCTGGGCAGCGGTAATGATCAC
GTGATGGACGCCGTGTCTCAGTGTGAACAGTACGCTAAAG
AGCAGGGCGCACAGGAGCGAAACGCCCCCTGGAGACTCTT
CTTCAGGAAGGAGATCTTCACGCCGTGGCACGACCCAGCT
GAGGACGCTGTCGCCACAAACCTCATTTACCAGCAGATCG
TACGCGGCGTCAAGTTTGGTGAATACCGCTGTGATCGGGA
GGATCTGGCGGAGCTGGCGTCGCAGCAGTATTATGTAGAT
TACGGCTCTGAGATCCTCGTTGAGAGACTGTTGAGTCTGA
TTCCCTCCTACATCCCGGACAGAGAGATCAGCTCGGCCAA
GACTGTGGAGAGATGGGCTCAGTTCATCATGGCTGCGCAC
AAGAAGGGCGTCTACACTCAGAAGAGGGTGGATCCTCAGA
AAGTCAAGGAGGAAGTTGTTGATTTTGCACGTTATAAGTG
GCCTTTATTATTCTCCAGATTCTACGAGGCCTTCAAGTTT
TCAGGTCCTAGTTTACCCAAGAATGATGTGATCGTGGCTG
TAAACTGGACCGGTGTGTATTTTGTGGACGAGCAGGAGCA
GGTTCTTCTGGAGCTCTCCTTCCCAGAGATCACAGCCGTG
TCCAGCAGCAAAGGCGGGAAACTTCAGGCTCAGAGCTTCA
CTTTGGCCACCATTAAAGCAGACGAGTTCACCTTCACCTC
TAATAATGCAGAGGACATTCGGGACCTGGTGGTCACTTTC
CTGGAGGGGCTGCGCAAGAGGTCAAAGTTCGTCGTGGCCT
TGCAGGACAATCCCAGTCCAGCTGCTGATGACTCCACATT
CCTGAGTTTCCTAAAGGGGGATCTGATCGTTCTGGACCAG
GACACCGGTGAGCAGGTCATGACGTCCGGCTGGGCTCACG
GCACCAACGACAGGACAAAACAGAGAGGAGACTTTCCCGC
GGACTGCGTTTACGTGCTGCCCACCGTGGTCAGACCACCG
CACGATGTCGTGGCTTTTGTCACGATGACCCCAGATCAGC
GTCAGGAGTCGCTCCGCATCTCACACGTCCCAGCACTGAC
TGAGACGGAGGAGAGGGTAAAGCCCTACACGCTGGAGGAG
TTCTCCTACGACTACTTCCGGCCTCCTCCTAAACACACTC
TGAGTCGAGTGATGATCACCAAGAACCGAGGGAAGGATAA
ACTGTGGTGCTGCACTCGAGAGCCCATCAAACAGGCGCTG
CTGAAGAAGTGTGGGGGACACGAGGAGCTCTCACAGGAGG
CTTGCATGGCTTTCATCGCAGTAATGAAGTATATGGGTGA
TTATCCGTCTAAACGCACACGCTCAGTGAACGAGCTCACG
GATCAGATCTTTGAAGGAGCGCTGAAGGCTGAACCACTCA
AAGACGAGATTTACTGTCAGATCCTTAAACAGCTGACAGA
AAACCACATCAAGTACAGTGAGGAGAAGGGCTGGGAGCTG
CTCTGGCTGTGTGTTGGTCTCTTTCCTCCCAGTAATGTCC
TCTTACCACACGTCCAGCGCTTTCTACAGTCCAAGAAACA
TCATCCTCTGGCTCTGGACTGCATGCAAAGACTACAAAAA
GCCTTACGGAACGGCTCCAGGAAATATCCTCCTCACCTAG
TGGAGGTGGAGGCCATTCAACACAAAACCACGCAGATCTT
TCACAAGGTTTACTTCCCTGATGACACAGATGAGGCATTT
GAGGTGGAGTCCAGCACAAAGGCTAAAGATTTCTGTCTGA
ACATCTCCAGCAGACTCTTACTCAAAACACCAGAAGGCTT
TAGTCTGTTTGTCAAGATCTCTGACAAGGTGATCAGTGTG
CCTGAGGGGGATTTCTTCTTCGACTTTGTCCGCCATTTGA
CCGATTGGATAAAGAAAGCAAGACCTGCTAAAGATGGTAT
AGTGCCTTCACTGACCTACCAGGTGTTCTTCATGAAGAAG
CTATGGACAACCACCGTTCCAGGCAAAGACTCCTTTGCAG
ACTCCATCTTCCACTATTATCAGGAGCTTCCTAAATATCT
GCGAGGATATCACAAGTGTTCCAGGGAGGAGGTTTTCCAG
CTCGGCGCTCTGATCTATCGAGTTAAATTTGAGGACGACA
AATCCCACTTTCCCAGCATTCCCAAAATGCTGAAGGAGAT
GATTCCTCAAGACCTGATTCGCCAGCTCTCACCCGACGAC
TGGAAAAGGTCGATTGTGGCGTACTTCAACAGGCATGCTG
GGAAATCAAGAGAGGAAGCCAAGCTGATGTTTCTGAAGAT
CATTTTCAAATGGCCCACGTTTGGTTCAGCCTTTTTTGAA
GTTAAACAAACCACTGAGCCGCACTTCCCTGAGATCCTGC
TGATCGCCATCAACAAATATGGAGTCAGTCTGATCGACCC
CAAAAACAAGGACATTTTAACCACATATCCCTTCACCAAA
ATCTCCAACTGGAGCAGCGGCAACACGTACTTCCACATCA
CAATCGGCAACCTGGTTCAGGGTAGCAAACTCCTGTGTGA
GACCTCACTGGGCTATAAAATGGACGACCTGTTGACCTCC
TACATTAGCCAGATGCTTACCACCATGAGCAAACAGCGAA
ACTCGCGCGGCGGCAGCAGCAAGTGAACGTTTGATTGGCT
GGAGGCGGTGGAGCTAGTGCGTCTGCTGCGTCCCATTGGC
CAGCCCTGCAGCTGGGGGCGGGCCTTCGCGGCGCAACTGT
GGCGGATGAGCAGAACTCCCTCTGCCAGCACACAGAGCTC
AATGTACCCGGATGAAGACTCTTCCTCTGAGGACGACTAC
CTCTGAACACACACACAAACACACGGATTCATCCGTTCTC
CAGAATATTCTTCAGATGCGCAATTTAGGTACCGTTTATT
ACGTTTTGTGAGTCGAATATAAACTGCAATGGCTTCTATG
CATCCCAAACTGCTTTAAAGAGGCAGTGTTTGGGTTATTT
ATGTGTAAATGCACTAAGAAAACAACATGTGCACGACTTC
CTGAAGAGTAATTGATTGATTATTTTTAATGGCGGCAGAA
ATATCTTTTATAATGGTTTAAATGTTAGTTTGTGTTCTGT
TTTAGGAGGTTGTGATTTAAATGTTGTGTTTTTAAAAAGA
TTATTTGTTGCACTGCAGGCCTTAATAGGTTTTTGTTTGG
GGGGGGATATGAGTAACTGCTTTTTTTTAACAGTACATGA
TCAGCATTCGTCCTCTAGTCTGTTGCTAAAATCTAATTTC
CAGCTTAATTGAAGATTAAACTTAATATAGATCAAGTGTA
CTTTGGGAGGGAAAATGAGAATGACGAAAATGAATGGCCT
TATTTAAAAATGAATATGAAAATGCGTCTATATTAATGCT
TCAGGCTGATTTATACTTCTGCGTCCAGTGATCGATGTGA
CTCACGGTGTCTGCATTGTGCATAGTCGTGCATTTATACT
TCTGCGTGCTGTTTGTGTTGCTCTGCAATAACACTTCTGA
AACACTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myo7aa-001 Contained in:
OTHER myo7aa-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045280 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AJ404001 (1) 7590bp
    GenBank:AJ404002 (1) 6802bp
    GenBank:BC163570 (1) 6713bp
    CITATIONS (1)