Transcript

nisch-002

ID
ZDB-TSCRIPT-091203-221
Name
nisch-002
Previous Names
  • ch1073-288d12.1-001
  • si:ch1073-288d12.1-001
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045837 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045837|OTTDARG00000009238|ZDB-GENE-050208-570 nisch|no_translation CH211-103F16.1-002 LG_none CU914599.3,CU104762.7,BX908397.7 Danio rerio protein_coding KNOWN, 1313 bp
AAGCTGTGTCTGAAAGATCCTAATAAGTCAGAATTATTAG
CCTTCCTGAATTATTAGCTTCCCTGTACATTTTTCCCCTC
AAATTTCTGTTTAACAGAGAGATTTTTTTCAACACATTTC
TAAACATAATAATTTTATTAACTTATGTCTTTTATCTTTG
CCATGATGACAGTACATCCTTTTTCACTAGATAATTCTCA
ACATAATAGTATTTAGCTTGAAAACTGATTGTGCTTATCT
TGTTTTGTGTGCAGATGGAGAACGAGGAGCTTAAGCACAT
CCTGTGGACATCTGTGCTCTTCTACAGGTCTCCTGATGTG
GAGACGACCGCCTGTGTCCTGCTGTCCAACAAAGCCATTT
ACTTCATCCTGGACGACAGCGCATCCTCGCTTACCAACCA
ATCAATGATGTGGACCTGGCAACCGTCCCAGAACAAGGAC
ACTGATTTCCTCGTCTCCTTCTGCTTCACCCTCAAACTGA
AAGACCTGCAGAGTGTCAATGTGGGCTTGTTCGATCAGTT
CTTCAGGGTCATGGGGCCTTCGGCTGATCACATCATTTCC
TGTCTGACCCGTGATGGTTACAGCACGCATCGCTTTCTGC
AGCAGCTAATGATGGTTTTATCACTTGTAGAGAAAGTTCC
CTCTCCTGAACCTTCAGAGCAGGATTTCTACTCGCAGTTT
GGGAATAAAAGCACAGGCAAAATGGAGAACTACGAACTGG
TCCATTCCAGCAAGGTGAAGTTTGTATATCCAAGCGAGGA
AGAAATCGGAGACCTCACCTTCATCGTGGCGGAGAGAAAG
ACTCCACAAGCGCTAACCTCTTTCAACATCCTTTTATATG
TACTCGTTTTCCAAGTCCATGTCGTTCCGGGACCGAACAA
GACCGTGTTGCAACCCAAAACTCTCATACTCACCAGCACG
GACGTCTTCCTTCTGGACGAAGACCATATTAGCTACCCGC
TTCCTGAATTCGCAAAAGAGCCGCCACAGAGAGAAAAGTA
CCGGCTAACAGATGCACGCCGCATACGCGATCTTGACCGA
GTGCTAATGGGCTACCAGACTTACCCTCAAGCCCTCACAC
TGGTTTTTGATGACGTTCCAGGACCGGATCTGTTGTGTCA
TCTTACTATGGATCATTTTGCGGACGCTGATGGTAAAAGC
GAAAGGACGCAGGGGATTGGAGGAGCTGAGGGCGAAGTAC
AATGGTGTATTTTTGTACCCGGAGCGGACAGTAGAGAACG
GCTAATATCGCTTCTGGCTCGCCAATGGGAGGCGCTGTGC
AGCCGAGAGCTACCAGTTGAGCTAACAGGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations