header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091203-166
Transcript Name: si:busm1-228j01.6-201
Previous Names: ch73-308b14.2-001, ottdart00000045635, si:ch73-308b14.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045635 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045635|OTTDARG00000032637|ZDB-GENE-030616-396 si:busm1-228j01.6|OTTDARP00000036021 CH73-308B14.2-001 LG_ CU914776.10 Danio rerio protein_coding KNOWN, 1136 bp
ATAAGATACACACAGCAGCATGAATGCAAAAATCAATTAC
AGTCTTGCGGCAGTGTTTTTGTCTGCTTTGTTTGAAACAG
TACATGCATATTACACATATGCTCAAATCCAGTGTCATGT
GTCTGACTCTCTACAAAAGATTGAATTTATCTTCTCTGTC
ACCTACAACATGATTGAACTTGTGAGATACAACAGTACTG
AAGATACGTTTTTTGGTTACACTGCAATTGGTCAAAAATT
TGCAGAGGAATATAATAAAGACAAAGTTTTACTTGCACAA
CATGATTTTGTGCTGAACCAATGCAGAGAACTTGGTGATG
TCATTTTACCTAATGCAGTTTGGCTTGCAGTGAAACCAGA
AGTCATTATTCGGTCAGTTACTGAAGCTAAAGGCAATCGG
AAAGCTGTCCTGGTGTGCAGTGCCTATGACTTTTACCCCA
AAGGCATCAAACTGACGTGGATGAGGGATGATAAAAAGGT
TACAGCTGAATTGACATCCTCTGAGGTGATGGCTGATGGA
CACTGGCACTACCAGATTCACTCCTACCTGGAATATTTTC
CTCAAACTGGAGAGAAGATCTCCTGTGTGGTGGATCACGC
CAGCTCCCTTAAACCCATGATCTATTACTGGGATCCCTCT
CTCCCCGAGTCTGAAAGATCTAAGATCATTCTTGGGGCTG
TGGGGCTGCTGATGGGGATTTTTACAGCAGCTGCAGGAGT
GATCTATTATAAAAGAAAACAAACAGGCTTTTACAGACTT
CCGGTTTGTTTACTTCCAATGGAAACAATGAACGACACTG
AACTGCAGTAGGCTGTGACATTTGATACTTAAACATAACC
TCCAGATCATCTGAGAGATCCACTGATTGAATAGGTGGAG
TGTCCTGCGTCAATCACATGCTTCATCTCTTGATTTGTTA
ATATTAATGTTTTCTCACCTGTCAATTCAAAGGTGACAAA
CTCTTAAAATAGATTATTGAAGATTAATGTTTTGTTACTT
GGACTTGACTTGATTTATGATGTAATTCTAATGTACATTT
CAAATATTATTACGTATACACTCTAGCACTTGACAGTGTA
CTCTACACTGAACTTGACAATGTTTTTGGAGATGACAATA
CTCAAATTTTCAAATA

si:busm1-228j01.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:busm1-228j01.6-001 (1) 912
si:busm1-228j01.6-201 1136
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:busm1-228j01.6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000045635 (1),  Ensembl_Trans:ENSDART00000098138 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC107516 (1) 1167 bp
GenBank:CO798204 (1) 819 bp
GenBank:EB980642 (1) 459 bp
CITATIONS (2)