ZFIN ID: ZDB-TSCRIPT-091203-13
Transcript Name: cplx3b-201
Previous Names: cplx3b-001, ch1073-122j16.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045265 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045265|OTTDARG00000032406|ZDB-GENE-091204-403 cplx3b|OTTDARP00000035769 CH1073-122J16.1-001 LG_ CU607071.8 Danio rerio protein_coding NOVEL, 601 bp
GGGAAAAAAGAGTTTTTCCTCTCAATACAGTTGGATTAAT
TGGAATTAATAGCAAATTTGGACAAACAGTTCGAGTGTTA
AGCAACATTACACTATTTAACGATGGCTTTTATGGTGAAA
CACGTAGTCGGAGGTCATCTGAAGAATCTGACAGGAGGTC
TGACAGAAGAGAAACCTGAAGGGGAGAAATCTGAAGCTGC
GGCTAAAGGAATGACACAAGAAGAGTTTGAACAGTACCAA
CAGCAGCTAGAGGAGGAAAAGGAAGAGCGGGATGCCAATT
TTGCCCAGAAGAAGGCGGAGCGGGCGACAGTCAGGTCTCA
CTTCAGAGACAAATACAGGTTGCCAAAGAATGAGGTGGAC
GATACTCAGATCCAGGCAGCGCGGGACGATGTGGAGCTGC
CCACCGAACTGGCTAAGATGATCGCACAGGACAACCAGGA
GGAGGAGCAGAAGCAATCAGTGCTGGGTCAACTAACCAAC
ATCCAGAACGTGGATATGGGTCATCTGAAAGACAAAGCCC
AGGCCACGCTGGAGGACCTGAAGAACTCTGCTGAGAAGTG
CTGCGTCATGTGATCTGGCCACGTTAAATGCACTACTATT
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cplx3b-201 Contained in:
[Fosmid] CH1073-122J16 (1)

Genome Resources: Vega_Trans:OTTDART00000045265 (1),  Ensembl_Trans:ENSDART00000121503 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB961055 (1) 526 nt
GenBank:BF938427 (1) 485 nt
CITATIONS (2)