Community Action Needed: Please respond to the NIH RFI
Transcript

cyp1a-201

ID
ZDB-TSCRIPT-091203-126
Name
cyp1a-201
Previous Names
  • cyp1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000045266 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000045266|OTTDARG00000032407|ZDB-GENE-011219-1 cyp1a|OTTDARP00000035770 cyp1a-001 LG_ CU462829.5 Danio rerio protein_coding KNOWN, 2608 bp
ACTCCTCTGGAGCTAATTGGCACTGGATAGAAACAGCTGA
GAACTGGAAAGTATCCACTCGATCGCTCCGGGTTATTAAA
TCAGCAATGGCTCTGACTATTCTTCCAATATTGGGTCCGA
TTTCTGTGTCTGAGAGTCTCGTGGCCATTATAACAATATG
TTTGGTGTATCTGCTCATGCGCCTAAACCGCACGAAAATC
CCAGACGGGCTACAGAAGCTTCCCGGCCCGAAGCCTCTGC
CGATTATCGGAAATGTCCTGGAAATCGGAAACAACCCACA
TTTGAGTCTGACGGCCATGAGTAAGTGCTATGGCCCGGTT
TTCCAGATCCAGATCGGCATGCGTCCTGTCGTCGTACTCA
GTGGGAATGATGTGATCCGACAGGCGCTCCTAAAACAGGG
CGAAGAGTTTTCCGGACGTCCAGAATTGTACAGCACCAAG
TTCATCAGTGATGGAAAGAGTCTGGCGTTCAGTACGGATC
AAGTCGGAGTCTGGAGAGCACGCCGAAAGCTGGCGCTCAA
TGCCCTGCGAACATTTTCAACAGTGCAGGGAAAGAGTCCC
AAATATTCCTGCGCCCTAGAGGAGCACATCAGTAATGAGG
GTTTATATTTGGTCCAGAGGCTGCACTCTGTTATGAAAGC
CGATGGAAGCTTTGATCCATTCAGACATATCGTAGTATCC
GTGGCTAACGTAATCTGCGGGATCTGTTTCGGACGCCGGC
ATAGTCATGATGATGATGAACTGGTGCGACTGGTTAATAT
GAGCGATGAGTTCGGGAAGATCGTGGGCAGCGGAAACCCT
GCCGATTTCATCCCTTTCCTGCGCATTCTGCCGAGCACGA
CGATGAAGAAGTTCCTGGATATCAACGAACGCTTCAGTAA
ATTCATGAAGAGGCTGGTGATGGAGCATTACGATACGTTC
GATAAGGACAACATCAGAGACATCACCGACTCTCTTATCA
ACCACTGCGAAGACCGAAAACTGGACGAAAACTCCAACCT
GCAAGTGTCCGATGAGAAGATCGTAGGAATCGTCAATGAC
CTATTCGGAGCCGGTTTCGACACTATCAGTACGGCTCTGT
CCTGGGCGGTTGTCTATCTAGTGCACTACCCAGAGGTCCA
GGAGCGACTGCAAAGAGAATTGGATGAAAAGATCGGGAAG
GATCGCACACCACTGTTATCTGACAGGGCGAACCTGCCGC
TTCTGGAGTCCTTCATTCTGGAGATCTTCCGTCATTCATC
CTTCCTTCCCTTCACCATTCCTCACTGCACATCCAAAGAC
ACGTCACTCAATGGCTATTTTATTCCCAAAGACACCTGCG
TGTTTGTAAACCAGTGGCAAGTCAACCATGACCCAGAACT
GTGGAAGGATCCCTCGTCTTTTATTCCCGACCGGTTCCTC
ACTGCGGACGGTACTGAACTGAATAAGTTGGAAGGCGAGA
AGGTGTTGGTTTTCGGTTTGGGAAAGCGCCGCTGCATTGG
AGAGTCCATCGGACGCGCTGAAGTCTTCCTGTTCCTGGCC
ATCCTGCTGCAAAGGTTAAAGTTCACCGGGATGCCAGGAG
AAATGCTGGATATGACCCCAGAGTACGGGTTGACCATGAA
ACACAAGCGGTGTCTTCTTCGGGTCACACCACAGCCTGGG
TTCTAGATCCAGAACTCCTCATCATGATCCAAAAATCAAA
GATTGAGCTCCTGAAATCCAGGAAAACTGGCCAGCAGGTG
GAGATGCTGAATATTAGAGATGTTTGTTCGCAGGTCAAAG
CATCCGATGCATTCTGATGCAAGCACACTGCAAAATACAT
GCTATTATTACTTACTATTAGAGTTTTGGTCTTGCTTCTA
GTCCAAATATCTCAAACGTCTTTAATCAAGAAGCATTTTG
TTGGCAAGTGAAACATCTTGTCTTGTTTTCAAACATAATG
AGTGAAAATTAAATGACGTTTTCCGTAAAACAAGCAAAAT
AATCTGCTTACTCTGTTTAAAAAACTCTGTTAAACAGCTC
TTTGGTAAGGAACTTTAATAATTGGGTAGTTTTGTTGTAA
ATTGTGCATATATGCATATCAGATGCACGCTTGCATGGCC
TTGTCCTTTCAAAACTGGAATGCTGATAATGTATTTGTGC
TTTCAAACATACCGCGGTAAAGCACAGATCAGGATGAAGA
GTGCCTGTTTTAGCTGCGGTTTAGCTGTCTATCAAAGCAA
TGCCTTCTGTCTTCATAAGCTTAATGCAGATTCATCTGCC
TGACGACATACACTGATGCAGTTTTCTAATTGATGATGAT
CCCCGAATGTGATCCACATGTAAATACGCAGCGGCTGTTT
CAATATGCACATTTTTTTTTACATGTGCCTGATTTTACTT
GTGTACAGATTTGTAATATCTACTTTTTGTATTTATCGAA
GTGCTTAATCAGATGTTTATTTCCTTGAGATATCGTGTCT
GTGACCTGCTGAAACTCTTCGCAGGTGCTCATAATTGTAT
TATGAAGGAATTCTGAAGTACTACTGCTATAATTAATTCA
TGCTAACATGGTCTCCAATGGCAGTTTGTTGTTGCATAGC
ATATTTATGATGTTGGCAAAATAAATAATAAAACTTCTAC
TGCTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations