header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-985
Transcript Name: nf1b-201
Previous Names: nf1b-001, ch211-262n1.5-001, dkey-15g19.1-001, si:dkey-15g19.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043469 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043469|OTTDARG00000031247|ZDB-GENE-091111-4 nf1b|OTTDARP00000034461 DKEY-15G19.1-001 LG_none CT573181.12,CU459057.8,CT573231.8 Danio rerio protein_coding KNOWN, 8675 bp
TCGGCGTGAGCGGCCATGGCGGCGCAGAAGCCCGTGGAGT
GGGTCCAGGCCGTCATCAGCCGATTCGACGAGCAGCTTCC
TGTGAAAGTCGGTGTTCAAAACACACACACTAAAATCAGC
ACAGAACACAATAAGGAATGCCTGATCAACATCTCCAGGT
ACAAATTCTCCCTGGTCATCAGCGGACTCACCAACATACT
GAAGAACGTCAACAACATGAGAATATTTGGAGATACTGCA
GAGAGGAATCTTTACCTGTCACAGCTAATCATCTTGGACA
CATTGGAGAAGTGCTTGGCAGGGCAACCGAAAGACAGCAT
GCGTCTAGACGAGACGATGCTTGTGAAGCAGCTGTTGCCG
GAGATCTGTCATTTCATCCACACGTATCGTGAGGGAAACC
AGCACGCGGCTGAGCTGAGGAGCTCCGCCTGTGGTGTCCT
GTTCTCTCTGAGCTGCAGTAACTTCAACGCCGTCTTCAGC
CGCATCTCCACCAGGCTACAGGAGCTGACTGTCTGCTCGG
AAGATACTGTGGACGTGCACGACATTGAGCTCATTCAGTA
CATCAATGTGGATGGCTGTAAACTCAAACGCCTCCTCCAA
GAAACTGTCTTTAAATTTAAAGCCTTAAAGAAGCCGGCAC
AGTTAAGTGTCATCTTCAATTTAGAGAAGGCGTTTTGGAA
CTGGGTGGAGAATTATCCTGATGAATTCACCAGGCTGTAC
CAGAGGCCTCAAACAGACATGGCTGACTGTGCTGAAAAGC
TGTTTGATCTGGTGGACAGTTTTGCCGAAAGCACGAAGAG
AAAAGCAGCTGTTTGGCCTCTCCAGATCATCCTCCTCATC
CTCTGTCCTGATATCACGCAAGACATGTCCAGAGATGCAG
CAGAGGACGCCAAAGACAACAAGAAGCTGTTTTTGGAGAA
TCTGCGGAAAGCTTTGACTGGCCACGGTGGAAGCAAACAG
CTGACAGAGAGCGCAGCCATCGCCTGCGTTAAACTGTGTA
AAGCGTCCACATACATCAGCTGGGAGGATCACTCTGTTAT
CTTCCTGCTGGTGCAGTCTATTGTCATGGACCTGAAGGGT
TTGCTGTTTAACCCAGTTAAGCCGTTTTCCAGAGGCGCAG
GAAGTCAGAGTGCAGACCTGGACTTAATGATCGACTGCTT
CGTCTCCTGTTTCAGAATCAACCCACACAACAATCAGCAG
TTTAAAGTGTGTTTGGCCTCGTCCTCCCCTTCAACCTTTC
ATTTCGTGCTGGTGAATTCTCTCCACCGCATCATCACTAA
TTCTCCACTGGACTGGTGGCCGAAGATCGACACAGTGTAC
TGTTATTCTGGAGAGCTACGGCTCATGTTTGCGGAGACTC
TGGGACGAGTGGTGCAGGGCTGCAGTCACACAACGCTTCG
ATTGACTCCGAGTTTGACGTTTAAGGAGAAAATGAGCAGT
CTGAAGTTTAAAGAGAAAACCACTGATCTGGACACCAGGA
GTCTGAAGTATCTGCTCTTGGCTCTGGTGAAACTCATACA
TGCGGATCCCAAACTGATGCTCCATAATCCAGGAAAACAA
GGTCTGGAGGTTCACAGCAGCACAGCAGAGCTCATCACAG
GCCTCGTCCAGCTCGTGCCTCTTGCTAACATGGGAGAGAT
TTCCCAGGAGGCCATGGAGGCTCTGCTGGTCCTGCATCAG
CCTGAAAGCATTGAGCTGTGGAACCCGGATGCCCCTATGG
AGACCTTCTGGGACATCAGTTCTCAGGTGCTTTACTTCAT
CTGTAAGAATCTGTTTGGTCATCCGCTGGTTAGCAGTACT
GAGATTCTGAAATGGCTGAGAGAGATTCTCATCTGCAGAA
ACAAGTTTCTTCTAAGGAATAAGGATCGGGCCACAGTGGG
CAGCAACATTGCTACCTGCCGGCAGGCTCAGACCAAGCTG
GAGGTCTGTCTCTACATGTTCCTGTGGAGTCCAGACATGG
AGGCCGTTCTAGTGGCCATGTCCTGTTTCCGTTACCTGTG
TGAGGAGGCAGAAATCCGGTGCGGTGTTGAAGACATCCCA
GTGCAGTCTCTTCTGCCAAACTACAACACCTTCATGGAGT
TTGCCTCTGTCAGTAACATGATGGTCACAGGTCGTTCAGC
TCTACAGAAGAGAGTAATGGCTTTGCTTCGGAAGATTGAA
CTTCCCACTCCTGGAAACACAGAGGCCTGGGAAGACACGC
ATGCCAAATGGGAACATGCAACCAAGTTGATTTTAAGTCA
CCCGAAAACGAAACTGGAAGACGGTCAGGAATGGATCAAT
ATGACAGGCTTCTTGTGTGCGTTGGGCGGTGTGTGTTTGC
AGCAGAGGCATGTGTCAGCTCTGGCCACCTACAGTCCTCC
TATGGGCACCCTGAATGACCGCAAGGGCTCGATGGTGTCG
ATGAGCTCTTGTGAGGGCAGCCCAGAGACACCTCTCGGCC
GCTTTCTGGACCGTCTTCTGTCCCTGATGGTGTGCAGTCA
CGAAAAAGGCCATCAGATCCGCACTAATGTCAAAGACCTG
GTGGGGCTGGAGCTCAGTCCAGTGCTTTACCCAATGCTCT
TCAACAAACTCAAGAACAGCATCAGCAGATTCTTTGATGC
CCAGGGGCCGGTGCCAATTAATGAGACCAACACACAGTTT
GTGGAGCAGACCATCGCCATCATGAAGAACCTTCTGGACA
ACCATACAGAAGGTAGCTCGGAGCATCTGGGTCAAGCCAG
CATTGAGACCATGATGCTCAACCTGGTCAGGTATGTGCGT
ATTCTTGGCAACATGGTTCATGCCATTCAGATTAAAACCA
AATTGTGTCAGCTGGTGGAGGTCATGATGGAGCGCAGAGA
TGATCTTTCCTTCTGCCAGGAGATGAAGTTCAGGAATAAG
ATGGTCGAGTATCTGACAGACTGGGTGATGGGAACCTCCA
ACCAGGCTGCTGATGATGATGTCAAATGCCTCACCAGGGA
TCTGGATCAGGCGAGTATGGAAGCGGTGGTGTCTCTTCTG
GCCGGTTTGCCTCTTCAGCCAGAGGAAGGTGACGGAGTGG
AGCTGATGGAGGCCAAATCTCAGCTCTTCCTGAAATACTT
CACTCTGTTCATGAACCTGCTGAACGACTGCAGCGAGGTG
GAGGACGAGGGTCAGCCGGTGGTCGGGAGGAAGCGAGGCA
TGTCCAGGCGATTGGCATCATTACGACACTGCACCATCCT
GGCCATGTCCAACCTGCTTAGTGCCAATGTGGACAGCGGC
CTGATGCACTCTATCGGCCTGGGCTATCATAAAGACCTTC
AGACCAGAGCCACCTTTATGGAGGTGCTCACCAAGATTCT
TCAGCAAGGCACAGAGTTCGACACGCTGGCAGAGACGGCT
CTGGCGGACCGCTTCGAGAGGCTGGTGGAGCTCGTCACCA
TGATGGGGGATCAGGGCGAGTTGCCCATCGCAATGGCTCT
GGCCAGTGTGGTGCCCTGTTCACAGTGGGATGAACTGGCA
CGTGTTCTGGTAACTCTCTTCGACTCGAGGCATCTGTTAT
ATCAGCTCCTGTGGAATATGTTCTCTAAAGAGGTGGAGTT
GGCGGATTCCATGCAAACGTTGTTCCGTGGCAACAGCCTG
GCCAGTAAAATCATGACGTTCTGCTTTAAGGTGTATGGAG
CCACATATCTGCAAAAGCTGCTGGAGCCGCTGTTGAGAAG
TGTGATTGCGGGCACCGAGTGGCACATGCTGAGCTTTGAG
GTGGATCCTACCAGACTTGAAAATGGTGAAAATTTGGAGG
AGAACCAGCGGAATCTGCTTCGAATGACTGAACGCTTTTT
TAAGGCCATAATCAGTTCATCTGGAGAGTTTCCTCCTCAG
CTGCGCAGCGTCTGTCACTGTCTCTTTCAGGCTACATGTC
ACTCTCTCCTGTCTAAAGCCTCTGTCAAAGACAGAAAGGA
AGTGAGGAAAGCAGTCGTGAGCCAGCGTTTTCCTCAGAAC
AGCATTGGAGCTGTAGGCAGTGCCATGTTCTTGCGATTCG
TGAATCCAGCTATAGTCTCTCCATACGAGGCTGGGATTCT
TGACAAAAAACCTCAGCCTAGGATAGAAAGAGGCCTAAAA
CTCATGTCCAAGATTCTCCAAAGTATTGCCAACCATGTTT
TGTTCACAAAAGAGGAGCACATGAGGCCTTTCAATGACTT
TGTGAAGAGTAATTTTGATGCTGCCAGAAGATTTTTCCTG
GACATCGCCTCTGATTGCCCTGCTAGCGACTCTCTCAACC
ATAGCCTGTCCTTTATTAGTGATGGGAACGTTCTGGCTCT
GCACAGACTGCTGTGGAACAATCAAGAAAAAATTGGCCAG
TATTTATCTAGCAACAGGGATCATAAAGCAGTCGGAAGAA
GGCCTTTTGATAAGATGGCCACCCTGCTCGCTTACCTGGG
TCCCCCAGAACACAAACCTGTGGCAGATACTCACTGGTCC
AGTTTGAATCTTACCAGCTCCAAATTTGAGGAGTTCATGA
CAAGGCACCAGGTCCATGAGAAAGAAGAGTTCAAAGCATT
GAAGACTCTACACATCTTCTACCAGGCTGGAACATCAAAG
AACGGAAACCCTGTGTTTTACTATGTGACGCGCAGGTTCA
AGACGGGCCAGATAAATGGGGACTTGCTTATATACCATGT
CCTTCTCACCCTCAAACCATACTATGCCAAACCCTATGAG
CTAGTGGTGGATTTAACCCACGCTGGTCCAAGCAACCGCT
TCAAGACCGACTTCCTCTCCAAGTGGTTTGTCGTCTTTCC
GGGATTTGCATATGAAAACGTTGCTGCCATTTACATCTAT
AACTGTAACACATGGGTCCGGGAATATACCAAATATCATG
AGAGACTCTTGACGGGACTCAAAGGCAGTAAGAAGTTACT
GTTCATTGATTCGCCTGCACGGTTGGCTGAACATGTGGAA
CCAGAGCAACAGAAGCTTCCGGCAGCTACACTTGCACTGG
AAGAAGACCTGAAAGTCTTTCACAATGCGCTAAAACTGGC
CCACAGAGACACCAAAGTATCTATTAAGGTGGGCAGCACA
GCAGTGCAGGTCACCTCAGCCGAACGAACACGAGTTTTGG
GTCAATCGGTCTTCCTCAACGACATCTACTATGCTTCAGA
GATCGAGGAGATTTGCCTAGTGGACGAAAATCAATTCACA
CTGACTATCGCTAACCAAGGGACGCCGCTGACCTTCATGC
ACCAGGAGTGTGAGAGCATAGTTCACTCCATTATCCACAT
CCGCACGCGCTGGGAGCTTTCCCAACCTGACTCCATTCCT
CAACACACCAAAATCAGGCCCAAAGATGTTCCTGGGACCC
TTCTCAACATCGCTCTCCTAAACCTGGGCAGCTCGGACCC
CAGTTTAAGGTCTGCAGCTTATAACCTCCTGTGCGCCTTA
ACATGCACCTTTAACCTGAAGATCGAAGGGCAGCTTCTGG
AGACGTCTGGCCTGTGCATCCCTGCCAATAACACTCTATT
CATCGTGTCCATTAGCCAGACTCTAGCGGCTAATGAGCCT
CACCTGACCCTGGAGTTCCTGGAGGAGTGTATCTCTGGAT
TCAGCAAGTCCAGTATAGAACTAAAGCACCTGTGTTTAGA
GTACATGACTCCTTGGCTGCTGAACCTGGTACGCTTCTGC
AAGCATAGCGATGATGCCAAAAGGCAACGAGTCACCGCCA
TTCTGGACAAACTCATTACCATGACCATCAACGAAAAGCA
GATGTATCCATCCATTCAGGCCAAGATCTGGGGGAGCTTG
GGCCAGATAACTGATCTCCTTGATGTAGTTCTGGACAGTT
TCATTAAAACCAGTGCGACAGGAGGTCTCGGATCCATCAA
AGCTGAAGTGATGGCGGACACTGCAGTGGCTTTGGCTTCT
GGGAATGTCAAATTGGTGTCAAGCAAGGTGATCATTCGCA
TGTGCAAAATCATCGATAAGACGTGTCTGTCGCCCACACC
AACACTGGAGCAGCACCTGATGTGGGATGATATCGCCATC
CTGGCCCGGTACATGCTCATGCTGTCCTTCAACAACTCTC
TGGATGTAGCCGCACACCTGCCGTACCTGTTTCATGTGGT
GACCCTGCTGGTGGCCACGGGGCCTCTGTCTCTGCGGGCC
TCCACGCATGGCTTGGTCATCAACATCATCCACTCCCTCT
GCACATGCTCCCAGCTGAGCTTCAGCGAGGAGACCAAGCA
GGTGTTGCGTCTCAGTCTGACCGAGTTCTCCCTGCCGAAG
TTCTACCTGCTGTTCGGCATCAGCAAGGTCAAGTCGGCTG
CGGTCATTGCATTTCGTTCCAGCTACAGGGATCGCTCATT
CTCGCCGGGGTCCTATGAGAGAGAGACCTTTGCTCTGTCA
TCTCTGGAGACGGTCACAGAGGCGCTGCTGGAGATCATGG
AGGCTTGCATGAGGGACATTCCAGGCTGTAAATGGCTAGA
CCAGTGGACCGATCTGGCGCAGAAGTTTGCATTTCAATAT
AATCCATCCCTCCAACCACGGGCACTTGTGGTATTCGGCT
GCATCAGCAAACGAGTCACACATACGCAGATGAAACAGAT
CATACGGATCTTGAGCAAGGCCAGCCTTCTCCTCAGCATC
GACCGGGGTTTGGAGAGCTGCCTGAAGGGTCCCGATAACT
GTAACAGCCAGGTGCTAATCGAAGCCACAGTCATTGCTCT
CACTAAACTACAACCTTTGCTCAACAAGGACTCAGCGATG
CACAAAGCTCTGTTCTGGGTCGCTGTGGCCGTACTGCAGT
TGGATGAGGTGAATCTGTATTCTGCAGGAACTGCTCTGCT
TGAACAGAACCTACACACACTCGATAGCCTGAGAGTCTTC
AACGACAAGAGTCCTGAGGAGGTGTTTATGGAGATCCGTC
AGCCTCTGGAATGGCACTGTAAACAAATGGACCACTTTGT
TGGCCTCAATTTTAACTCCAACTTCAATTTTGCTTTGGTC
GGTCACCTGTTGAAAGGGTTCAGACACCCCTCCCCCACCA
CAGTGGCACGTACCATCCGCATCCTGCACATGCTGTTGGC
GTTAGTAGGAAAACACCAGAACTGTGATAAATTTGAGGTG
AACACACAGAGTGTGGCGTATCTGGCAGCGCTTCTCCCGG
TGTCAGAGGAAGTGCGCAGCCGCTGCAGTCTGAAACACAG
AAAATTGTTGCTTTTCTCTGATGTCACAATGGAGAATGTT
CAAATGGATCCGTATTCTGTACATCACGAGGATCCAAGCG
GCAGAACGTTGCGGGAAAACGAGCTGTGGGCATCCCCGAA
AGTCTCAGAGCGATACTTGGTGGCCCATTTCCCCATAATG
GGGCAGATCAGCCCACGAACACGCAAATCAATGAGCTTGG
ACATGGGACAACCCTCTCAAGTCAACACCAAGAAGCTTCT
GGGCACCAGAAAAAGCTTTGACCTCCTGTTATCAGACAGC
AAAGCACCAAAGAGGCCTGAAATAGAGACTGGTATCACAA
CGCCACCCAAGATGAGGAGAGTGGCTGAAAACGAATATGA
AATCGAAACCCCAAGAATCTCCCATCACCACTTGCGGAAG
GTTTCTGTGTCCGAGTCCAATGTCCTGCTTAATGAAGAAG
TTCTCACAGATCCCAAAATCCAAGCACTGCTTCTGACTGT
GCTGGCCACTCAGGTGAAAAACACTTCAGATGAATTTGAG
CAGAGGATCTTGTATGAGTTTCTAGCCGAGGCCAGTGTTG
TCTTCCCAAAAGTCTTTCCTGTTGTTCATAATCTTCTGGA
CTCTAAGATTAATACGTTGTTGTCGCTGTGTCAGGACCCA
CATCTTCTGAATCCAGTTCATGGAATTGTTCAGAGTGTAG
TTTATCATGAAGAGTCTCCACCTCAGTACCAACCGTCCTA
CCTGCAAACTTTTGGGTTTAATGGACTCTGGAGGTTTGCC
GGTCCTTTTTCGAAGCAAACTCAGTTCCCAGACTATGCAG
AGCTGATAGTCAAGTTTCTGGATGCACTGATTGACACCTA
TCTTCCGGGCATTGATGAGGAAACAAGCGAGGAGGGTCTG
CGGACACCCACCTCTCCATACCCTCCACCTGTGCAGAGCC
AGCTCAGCATCACTGCCAACCTCAACCTCTCAAATTCAAT
GACCTCGCTGGCCACCTCCCAACATGCACCAGGAATGGAT
AAAGAGAAAGTGGATCTATCCCCCACCACGGGTTTGGCAG
CCGGCGGACGCACACGCCACGGCTCGGCCAGCCAGGTCCA
GAAACAGCGCAGCACCGGCAGCTTTAAGAGACCTAGCATT
AAAAAGATTGTATGAGAACTGCAGCACAGCAGGGTTTCGC
CTCTGCTGGACCTCTAACATACATTCTGCTGCCTTTTCTG
CGGCTTCTCTTCACTCCCGCTAAACCCAGCATTTACGATA
ATCTTTAGGTTCTGCTGTTCGGGATCCAAATGAAAACCTC
TGTTTTTAAAACCAGCCACTGTTTAACACGGATGGGAGGA
CGTCCAGTATTTTTAGTTATATTTGTGCATAATAGAACTG
AATAGTATATTGTTTTTTAAAAGCACTACATTCTTTCTTA
CTTTTAATACGTGGAAGTATTAACCAAGTGCCATTCCTTT
GTTGCATTTATTTGGTTTGATTTATGAGACGCTTAAAAGA
AATGTACAATCGTTCATGAACAACTACAAAAACGT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nf1b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043469 (1),  Ensembl_Trans:ENSDART00000131897 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CR929257 (1) 539 bp
GenBank:CR930343 (1) 539 bp
GenBank:CR927787 (1) 530 bp
CITATIONS (3)