Transcript

slc4a4b-201

ID
ZDB-TSCRIPT-091110-982
Name
slc4a4b-201
Previous Names
  • slc4a4b-001
  • dkey-106a24.1-002
  • dkey-93m18.7-001
  • ottdart00000043459
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043459 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043459|OTTDARG00000031240|ZDB-GENE-091030-1 slc4a4b|OTTDARP00000034452 slc4a4b-001 LG_none 25876 FP243383.11,CABZ01071003.1,CU928056.2,BX530036.7 Danio rerio protein_coding KNOWN, 3571 bp
TGCGGAGCGCGACGCCACGCGTTTCTCGACCGGACAGAGA
GAGCTCCTGATCCCGCTGCGGAATGACTGCTGGACTGCCC
GAATGTACTGTAGTTTGTAGAAGCAGCAGCGGTGAAACAT
CTCTGGCTCCAGATAAACTCAACTGAAAGCGTTTCTGCTT
TACGCATCCAGACGCGCTTGAACTTGGAGCGAAATCGCAC
TTCTTTAAGAGAGAGTTTCTCGCTCGGACGCACTTTTTAA
TCCAGAGTTCCATAAGAAGAAAGTGGTTCTCTTGGAGAAG
AGGACGCCAATTGTCAACATGAGCGACAAAAACAAAATGG
AGGATGAAGCTGTAGTGGACAGAGGAGCATCGTACATCAA
AAACGTGTGTGACGAGGAGGTCGAAGGTCATCACACAGTC
TACATTGGTGTTAATGTGCCTAAAAGTTACCGGCGGCGCC
GCCGACACAGACGACGATCCAGTCACAGAGAGAGACGGGA
ACGAGTGACGGAGAACGTGAGCGACAAATCAGACACCGAG
AACGCAGACGACTCCTCGTCCAGCATCCTCAAACCACTCA
TTTCTCCGGCAGCAGAGCGAATACGCTTCATTTTGGGTGA
AGATGACAGTGGTCCTCCCCCACCGCAGCTCTTCACCGAA
CTTGACGAACTTCTTGCCGTTGACGGACAGGAACTGGAGT
GGAAGGAAACAGCCAGATGGATAAAGTTTGAGGAGAAGGT
GGAGAAGGGTGGCGAGCGCTGGAGTAAACCTCACGTGGCC
ACTCTTTCTCTGCACTCGCTCTTCCAGCTCAAGAACTGCA
TCGAGAAGGGAACCATCGTGCTGGACATGGACGCAAACTC
ACTGCAGCAGATCGTCGAAAACATCACTGACAGTCAAATC
GAGAGCGGGCAGCTGAAGGCCGATCTGAGAGAGACGGTCA
TATACACTCTGCTGAGGAAACATCGACACCAGACCAAAAA
ATCCAACCTGCGCTCACTGGCAGACATCGGCAAGAGTGTG
TCGAGCGCCAGTCGCCTGTTCAGCAGCCAGGAGAACGGCA
GTCCGACCACAGCTCATCGTAACCTGACCTCCACCAGCCT
GAATGACTTGTCAGACAAACCAGAGAAAGACCAGTTGAAT
AATAAATTCATGAAGAAAATCCCCCGGGATGCCGAAGCGT
CAAACGTGTTGGTGGGAGAGGTGGATTTTCTCGACGCTCC
ATTTGTTTCGTTTGTTCGCCTTCAGCAGTCGGTTATGTTA
GGAGGTCTGACCGAAGTTCCGGTTCCCACACGCTTCCTTT
TTATTCTGCTGGGGCCCAAAGGAAAGGCCAAATCATACCG
TGAGATTGGACGTGCCATCGCCACGCTCATGTCTGACGAG
GTGTTTCATGACATTGCGTATAAAGCGCGAGATCGCAGCG
ACCTGCTGGCCGGGATCGATGAGTTTCTGGATGAAGTGAT
TGTCCTTCCTCCAGGAGAGTGGGATCCTGACATCCGAATC
GAGCCTCCGAAATCCGTCCCGTCTGCTGATAAACGTAAGA
ACAATCTTGCTGGAGGGGAAGGTTCTCAGATGAATGGAGG
AACGCCTCATGATGGAGGTTCGGGTGGCGGCGGTGGACAC
GCTGTCGGGGATGAACTCAAAATGACTGGCAAGTTTTGCG
GGGGTCTCGTTCTGGACATCAAAAGGAAACTACCGTTTTT
CGCAAGCGACTTTTATGACGCTCTGAACATCCAGTCTCTG
TCCGCCATCTTGTTTATTTACCTGGGTACAGTAACAAACG
CCATCACGTTCGGAGGCCTGCTAGGAGACGCCACAGAGAA
CATGCAGGGTGTATTGGAGAGTTTTGTCGGGACGGCGCTG
ACAGGTGCAGTTTTCTGTCTGCTCGCTGGTCAACCGCTCA
CAATCCTGAGCAGCACCGGCCCTGTGCTCGTGTTCGAGAG
ACTGCTGTTCAACTTCAGCAGGGAAAATGCTTTTGACTAT
CTGGAGTTCCGGCTGTGGATCGGCCTGTGGTCTGGCTTTA
TGTGTCTGGTTCTGGTGGCGACCGATGCCAGTTTCCTGGT
GCAGTATTTCACGCGCTTCACAGAGGAAGGTTTTTCTGCG
CTCATCAGCTTCATCTTCATCTATGACGCCTTCAAGAAGA
TGCTCAAACTGGCTCATCATAACCCCATCAACTCCGGCTA
CGACCTGGAGCTGGTCACCCAGTATGGCTGCCACTGCACA
CCTCCAGAAGGGAACGTTTCAGCCCTGTACTTGGAGAAAA
TGGAAGCCTTGATGAACAACACTGGACAGCATCACCTGAA
TGCGACGTGGGCGTCTCTGTCCCGCTCTGAGTGTCAGGAA
TGGGGGGGTCAGCTGGTGGGAGCGACGTGTGACTTCGTCC
CAGACATCACACTCATGTCTTTCATCCTGTTCTTCGGCAC
ATACGCCTGCTCCATGGGGCTCAAGAAGTTCAAGACCAGC
AGATTCTTTCCCACTACGGTCCGCAAGCTGATCAGTGATT
TCGCCATTATTCTGGCCATTCTGATCTTCTGCGGTGTGGA
CGCTCTGGTCGGCGTTGATACACCCAAACTCATCGTGCCG
AGTGAATTCAAGCCGACGAGTCCGCATCGAGGCTGGTTTG
TGGCCCCGTTTGGAGGAAACCCTTGGTGGGTTTATCTGGC
GTCTTTCTTGCCCGCTTTGCTGGTCACCATCCTCATCTTC
ATGGACCAGCAGATCACAGCCGTCATCGTCAACCGCAAAG
AGCACAAGCTCAAGAAAGGAGCCGGGTATCATCTGGACCT
GTTCTGGGTGTCGATTCTCCTGGTTGTGTGTTCGTTCTTG
GGTTTACCATGGTATGTCGCAGCGACTGTGATCTCCATCG
CCCACATCGACTCGCTCAAGATGGAGACCGAGACGTCCGC
TCCTGGAGAACAGCCCAAGTTTCTAGGAGTCCGGGAGCAG
AGAGTCACAGGAATAATGGTGTTTATTCTGACCGGTCTCT
CCGTCTTCATGGCCCCCGTTCTGAAGTTCATTCCAATGCC
GGTGCTGTATGGTGTGTTCCTCTACATGGGCGTCGCCTCG
TTAAATGGGGTTCAGTTTTTGGATCGCCTGGAGCTCCTGC
TGATGCCTGCAAAACACCAACCGGATCTGATCTACCTGAG
ACACGTCCCACTCAGACGAGTTCACCTCTTCACCTTCATA
CAGGTTCTGTGTTTGGCTCTGCTGTGGATCCTCAAGTCAA
CAGTAGCCGCCATCATCTTCCCTGTCATGATCCTCGCACT
GGTGGCTGTGAGAAAGGCCATGGATTATGTGTTCTCGCAG
CACGATCTCAGTTACCTGGATGACGTCATGCCGGAGAAAG
ACAAGAAGAAGAAGGAGGACGAGAAGAAGAAGAAGAAGAA
GAAAGGCAGCATCGACAGCGACATGAATGATGAGATAAGC
CCATGTCCTTCCTCACTCCCTACTGATGCAAAGCACTTTT
TCCCTTCCAGGACTGTGTCAAGTCAGGATTTAAACCCCTT
TAAGAAGATGGTGCCTCAGATCCGAATCGATTTGGACCCC
GACAACAACAAATTCTTCTGGAAAACTCCGTCCTCCGAAA
CATCCCTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations