Transcript

scaf4a-202

ID
ZDB-TSCRIPT-091110-915
Name
scaf4a-202
Previous Names
  • scaf4a-001
  • synj1-003
  • dkey-50p8.3-001
  • ottdart00000043234
  • si:dkey-50p8.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043234 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043234|OTTDARG00000031094|ZDB-GENE-030131-9003 scaf4a|OTTDARP00000034276 DKEY-50P8.3-001 LG_none AL837524.9,AL935277.6 Danio rerio protein_coding NOVEL, 3968 bp
GTCTGCTGCCAGGGGCGGACATGTTGGGGCGGCCTGCTGG
AGGACAGTACCACACATATTTCTGAATTTACCCGAGAAAG
CGACCGCGGAGCAGAGACGGGACGCCATGGACGCCGTCAA
CGCGTTTAATCACGAGAGTTGTTCTCCTTGATGGACACCA
AGCCCCCCATCTCGAGGGCCAAGATGATCTCTATCACCAA
ATCTGCCATAAAAGCTATCAAATTATACAAGCATGTTGTC
CAGATAGTGGAAAAGTTCATAAAGAAGTGCAAACCGGAGT
ACAAAGTTCCCGGTCTCTATGTGGTGGATTCCATTGTGAG
ACAGTCACGGCATCAGTTTGGAGCAGATAAAGATGTGTTT
GGACCCAGGTTTACTAAAAACATCACTGGGACATTTGAGA
ATCTATGCTTGTGTCCCACTGAAGATCGGAGTAAGATAGT
ACGAGTGCTCAACCTGTGGCAGAAGAATGGAGTGTTTAAG
ATCGAGGTCATTCAGCCTCTGTTGGACATGGCTGCTGGGT
CCAGCAGCTCCTCAGGCTTGGACAATGGCCCAGATGCAGC
TTCTCCACAGTCTCCCGTGAGGGAACAGGAGGCTCATCCT
GTGGTGACGACAAACTCAATTGTAGCAGCTGTGCCTCAGC
TTCAGAACTCGGATGCCTTTGCTGCAGTTGCTCAGCTAAT
TCAGTCTTCTCAAGGACAGCAGCTTCAGCAGATGCTGCAG
AACTTTCAGCCACCAGGGAAACCTCAGTCTCCGGTGGTGG
ACAATAACAGGAGTCATCTCCATCTACAAGCCCAGGCTAT
AGCACCCCCATCCACCATCCCACATCAGCACATCCATCAC
GCACCGCAGCCTGTGGAAAAGAAAGCCACCTTCGACAAGA
CAATTCTTGACCGCTTTGACTATGACGATGAGCCAGATGC
AGGAGAGGATGCCAAGAAGGAGGAAGCGCAGTCTGTCCAA
CCTTCTATGGGTTTTCCTGAGCAAACTGTCCCAGGATTTC
CTCCAGCCAATCAGATGCAGCACTTTCAACAGCATATGAT
GGCTGTATCACAGCGCCAACAGGTTGTTCTACCTTCAAAT
GGACAGGTCCAAGGCTTTGGTCTCATGACCTCTCAGCCCT
ATCCAGGCATGATGCCTCCAATGGGGCAGCCGAACGCAGC
TTTCCCTCCTCAAAATGAGGCCTTCAATCAACTCATGTCT
GGACATGCGGAAAGTCTGATGAATTCAGATGCATCTGCGA
GGTCTGCCCATGAAGACAAGAGGTCAAGGTCACGCTCGGG
GTCGAGGTCTCCTAAAAGAAGAAGGTCTCGATCCAATTCC
CGGTCCAGACGAATGAGGCATCGACGATCTCGGTCTCGAG
AACGGCGGCGTCAGTCACCTCGCTCGCGCTCTCAGGAAAG
GAGAGACAGAGAAAAGGAAAGAGAACGAAGACAGAAAGGC
CTCCCTCCTGTTAAAAATAACACACTCAGTGTGTGCAGCA
CAACTCTATGGGTGGGTCAGCTGGATAAGAGGACACAGCA
GCAGGACGTGGCCTCTATACTAGAGGAGTTTGGCCAGATA
GATTCAATTAATATGATTCCTCCACGAGGTTGTGCCTACA
TCGTCATGATTCATCGTCAAGATGCCTATCGAGCCCTGCA
AAAACTAAGCAGAGGTCCATACAAAGTCAACCAGAAAGCC
ATTAAGATTGCCTGGGCTCTAAATAAGGGCATTAAGGCTG
AATTCAAGCAGTATTGGGATGTGGAATTGGGTGTTACCTA
TGTTCCATGGTCCAAGGTAAAGATGGAGGACTTGGACGTA
TTCAGAGAAGGAGGGATGCTGGATTCTGACACTCTTGCGC
CAGAATGGCGAAACTCTCAGATTGAACAGAAGACTGATGA
GTCTCAGAACGGCCGGCCAGAGGTGGGAAAAGTGGAAGAG
ACCCAAACTGTCATACCTATGCAGGTTCCTCCTGTCCAGC
CAATAGGAGCAGTCGGTGTCCCACCTCCGGGATTCCCAGC
ACACATGAACATCCCACCACCCTCATTCCCACCTGGTGTT
CCTCCACCTCCAGGTCCCTTCATGCGGCCAGCCTTTAACC
CCATGCAGATGCCACCAGGATTTCTCCCACCGGGTGCCAT
GCCCCATATGGGTGCTGCTGGCCCTCCTCCACCTACAGCA
GGCATCGGGATGCCTCCAGTTGGCAGCTCTGTTGAAAACC
TGTCGAATGATTCAGCAGGTCTGGGCCCAAAAATCAGCAC
TGATGGAGCAGATGTGTTCAACTCAGGAAACCAGGTGCCT
CCTGGAGCTCCACCAGGGATGGGCATGCAGTCTCCTCCTG
GTCTTCTTGGCACAAGGCCAGGTATGATGCCTCTTCAGCG
GCCCCCGGGGATGCCACCTCCGCACATGCAGCGATTCCCC
ATTCCCCCACCTCGGGCAGGCATGCCACCCATGCCACCAC
AGATGATGCCACCCAGGGGTCCACCTCAGATGATGCACCG
CGAACCTCCACCGGGTGGTTTCAGCATGCCTCCTCCACCT
CATGGCATCCGGGGACCGTTCCCACCTCCCGGACCTCACT
TTATGAGGCCGAGCTTACCAAGGCCTGAGGGGCCAAATGA
TCATGAGGCTCGACCTTTTAGAGGAGAACGTCCCGGATTA
GGAAGAGGCCGAGAGCAGGACTGGTTTGGAGGACGACGGC
CTTTTGGTGAGGGACGTGGTGGGGAAAGACCAGATGGACG
TGAGCGGTTTGGAGGATGGCACGAGGAGCCAGAGAAACCA
GGTGGGTGGGAAAGAGAACGCAGGGAGGAACGCTGGAGGA
GAAGTCCAGATGGAGAACGAGGACGTGATGGTGGAGAGAG
GGAACGAGGACGCGATGGTGGAGAGAGGGAAAGAGGACGC
GATGGTGGAGAGAGGGAACGAGGACGTGATGGTGGAGAGA
GGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACG
CGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAG
AGGGAACGAGGACGCGATACTGGAGAGCGGGAACGAGGCC
GCGATGGTGAAGAACGGACCAAGCGGCCCGCAGGGAGCAG
AGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGAT
CGATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCT
CAGCAAATACCAACGAGCCCAGTGCAAACCCTACTAAAGA
ACTTGCTGAAGCCAAGCCAGATGTTCCAGCACCTTCTGCT
GCAGCTACAGCAGACTCGGAAGCTTCAGAACCCATAGCAG
AGAACAAATCTGAAGAACAAACACAAAAAGAGGAGTCGTA
GAGGCTTCTTTACTCATTAAGACCACATGAGCTTCTTCTG
TGTCAGTGCTAATCTTGAATACTGCTGGCTAAAAAGCAAA
GTCCAACTGTTGTGGGACGCTTTATGCATATGAGGATTGC
TTCGTCATCACAAACCAAGTTTTTCAAATTTGTGTTTTGG
CAAACGTGGAGCGTTGCCTTGTGAATTTATTGTCCCACCT
CAATGAAGCTTGAATGTTGTATTAAAACTGAAGATAAGGA
AAAGAAACGATTAATTGTTTGCTGTACATATGCTAACATT
ACTCCAATAATGTTTGTAGATTTTGACTGGCTTTTTTTTT
TTCCAATGATATCCCTGTTGAGTTTAATATTTGGAAACGC
TGACTAAAATATGACATTAAGACCCTTTTGCTGTAATGTT
TTTAACTTAATGTTTACAACATTCAAAAAAAAAAAAAAAA
AAAACGACACAAGATGTTTTTATCATTTTTAAGTTTTTGG
AGATAGGAACTCCAAATATTTCAGCGACAGGAGGTGGTTT
TAATAAAATATTTTCATACCAAATGAATGAACTGGTTTAT
GCAACTTGTTTTTAACATTTATTCTAGTCGTGCATTTAAA
ACTAATCATGAATAAAAAAACTGAGCTTTTTCTGAGCTTT
TAACTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations