Transcript

pcdh1a-203

ID
ZDB-TSCRIPT-091110-876
Name
pcdh1a-203
Previous Names
  • pcdh1a-001
  • dkey-18f22.3-001
  • dkey-88l16.4-001
  • ottdart00000043073
  • si:dkey-18f22.3-001
Transcript Type
mRNA
Annotation Status
Annotation Method
Havana
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043073 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043073|OTTDARG00000030983|ZDB-GENE-091116-32 pcdh1a|OTTDARP00000034166 DKEY-18F22.3-001 LG_none BX004800.12,BX510911.10 Danio rerio protein_coding NOVEL, 4201 bp
CGCGCGGTGCTGAGAAATCTCCTCACTCACTCTCTCACAT
GCATAGAAATGCAGGATTAACCCTGTGCGGAGAAGATTCC
TGTGCCAAAACTACGTTTATAGTCTACTTCTGAGGAAGGC
GAAGCGGTAAACCAGACTCCATACGTTTTGCCATGTACTA
TTACATTTCTACATTATTTCCGATAGATTATGCTATCATT
CCGTAACGTATAACGCGGAGCACTATCAACATTTTTGTGA
GAACCTGTACTCTCCTAAAATGAGTGTTTGAGGATTTATG
GACTGAAACGAGGGAAGTTGCGCGTTTTAGAACTGTCTCG
TTTGAGAACTGTCTGAGAAACAACAGCAAAGACATTTGAA
GACCCATCCTCGGGCGTAATTTCTCATTTATTAACACTTA
AATGAGTGCCGACGTTTTCAAACTGCTGCGGAGTCGTGGG
AATGGCGTGGAAGAATAACTCGGCCACTTATGGATTGTTT
CCCATCGGAAGGATTGTACGTTTTCTTGATGTGTGGATTC
TTTAAAGCAGGTGTTTAGGCCTCCGTGTCGAAGGAAACAT
CAGCTGTAGTTGATCCTCACCTCAGACAAGAAAACCTCGA
TCTCGGAAGGAAAAAGTGATCGACGAAGATGGATCTCCCT
GTGGTTTTGTTTCTGCTGTGGGGACTGTTACTGGACTTGC
TGACTGGTGCGGTTGGTGGCATTCTATACCGCGTTCATGA
AGAACAGCCTCCGAGCACACTGATTGGCAGCCTGGCAGCA
GACCAAGGCCTACCAGACACTGGACACCTGTACAAACTGG
AGGTGGGCGCTCCCTATCTGCGGGTGGATGGCAAAACTGG
AGATATCTTTACCACCGAGATCCCCATAGACAGAGAGACA
CTGAAGGATTGTCGTAATAAAGGCAAACCCTGCTTTCTGG
AGTTTGAGGTGTCCGTCACAGACCTTATTCAAAATCAGAG
TCCACGGCTGATAGAGGGAAGGATCGAAGTACAGGATATC
AACGATAACACACCACAGTTCCCCTCACCTGTCCTTACTC
TCTCAGTTCCAGAGAACACCCACATGGGGGCACTCTTCTC
AATTCCACTGGCCACTGATAAAGATACAGAGAGGAATGGA
GTAGCTGACTACACCTTAACAGCAGGACCAGAGGCTGTAG
CACTCTTTGGTCTGCAAGTTGCAGAGGATCGAGGTGAAAA
ATTACCTCAACTCATAGTGTTGGGAAGCCTTGATCGAGAG
CTGAAAGACTCATACGACCTCACCATCAAAGCTGTGGATG
GAGGAAATCCACCTCGCTATAGCAGTGCCTTGCTGAGGGT
TGTCATAGCTGATGCCAACGACAATGCACCAAAATTTGAA
AAATCCTCCTATGAAGCAGAGGTTGCAGAGAACAGCCCGA
TTGGACACTCTGTGTTACAGGTAAAGGCTAATGATTCAGA
CTTGGGACCTAATGGTGAAATTGAATACACATTACATCAG
GCCATTGATCCTGTGCCAAAACTGCTTCGGATAGATCGCT
CATCAGGCATCATATATGTCAAAGGACCTTTGGATCGTGA
GGAGATCAACAATTTGAAGTTTTACGTAGTTGCACGAGAT
AAAGGCCCTTCACCAAAAAGTTCTAAAACTTACGTTTCTA
TTGATGTGACAGACCAGAATGACAATGCACCAGCAGTGGA
GATTCGAGGAATTGGTCTTGTGACCCACAGTGATGGTGTA
GCAAATATTTCAGAGGATATGCCAGTTGGAACTGCAGTGG
CACTGGTGCAAGTTTCAGACAAGGACGAGGGAGAGAATGC
AGTGGTGACCTGTGTGGTTGCAGGGGATGTTCCTTTTCAG
CTTCGACCAGCTAGTGATTCATCAGTTGACAACAAGAGAA
AGTACTTTCTACAGACCACAACACCACTGGACTATGAAAG
AGTTAGGGACTACCGAGTGGAAATAGTAGCAGTGGATTCA
GGCAATCCAGCTCTATCCAGCACCAACTCTCTGAAAGTCC
AGGTGACTGACACAAATGACAATTCCCCTATTTTCTCACC
CACCCTGTTTGAAGTAGAGTTTGCTGAGGAAAACCAACCA
GGAGAAAAGGTGGTAGAGGTAGTTGCCTCAGATGCAGACA
GTGGAACTAATGCAGAGCTGGTCTACAGCATTATTGCAGA
CTCTTCAACAAGGGGCCTTTTTGAAATTGACCCCAACTCA
GGAGAAGTACGTGCTCGGAGCCCTCTCGATCGTGAGCACA
AGGACCGCTATGAGTTCCGTGTTACTGCAGCTGACAAAGG
GGTTCCCAGTCACAGAGGTACTGCCACAGTTGTAATCAAA
GTACTTGATCGGAATGATAATGACCCCAAGTTCATGCTGA
GTGGCTACAGCTTTTCAGTCTTGGAGAATATGCCACCCCT
TAGCCCTGTTGGCATGGTAACAGTACAGGACATGGATGAA
GGTGAGAATGCTCAAGTGCAACTTTCTGTGGAACCGGATG
TGGGCAAATTTGTGATTCAGAATGGTACTGGCACTATTCT
GTCCAGCATCTCATTTGACAGAGAGAAGGAGAGTAGTTAC
ACATTCAGGTTGAAAGCTGTAGATGGAGGAGACCCTCCCA
GGTCATCTTACGTTGGAGTGACCATCAATGTCCTTGATGA
AAATGACAATGCACCAGTTGTAACCAAACCATCGAATTCA
TCCTTTATACGTCTGTCTCCCATGGCTGCTCCAGACAGTG
TTGTTGAAGTTGTCGAAGCAGAGGACATTGATTCTGGTTC
CAATGCTGAACTAGTATACAGTATTGCTGGAGGAAATCCA
CATGACCTTTTTTACATCTCACCATCTAATGGCGAGATCA
CATTAACCAAGGAATTAACACGCAAACATAGTGGTCTGCA
TCGACTGGTCATAAAAGTCAGTGACAGGGGCAAACCATCC
CGCCATGCCATTGCCTTGGTACACATTTATGTTAATGAAA
CTATTGCCAATGTAAGTCATGTGGAGGCACTTGTGGGGCA
TAGTTTGTACACCCCACTCGACATGGACATTGCAGGAGAC
CCAGATTATGGTTTGGCTGCCCAAAGAAGTAACATTGTGT
ATGGCAGTTTAGCTGGAGTGGCAGGAGTCGTCACCGTGAT
CGTTGTTGTGGTCTTCATCAGACATCGCCTTCAAAGAGAA
ACTAAGAGTGGTTATCAGGCTGGCAAGAAGGAGACCAAAG
ATCTGTATGCCCCCAAGCAAGGGCCAAAAAGTGGCAAGGG
GAGAAAAGGTAAAAAAGGGAAGCCACCAAAGTCACCTAAA
CCTCTTGGAGAGGATGAAGAAGTCAGCCTTCAAAAGAGTC
TGAAATTTAACCTTGATGGGGTTAATGACAGCCCCAGGAT
CCATTTGCCTCTGACATATCCGCCTGGAAGCCCTGACCTG
GGCAGGCACTATCGTTCCAATTCCCCATTGCCCTCCATCC
AGCTCCAGGCCCAGTCCCCATCTGCCTCCCAAAAGCATCA
GGCTGTCCAGGAGCTCCCTGCTGCCAATACCTTTGTGGGA
ACAGGCGGGGATGACAACTCCACCGGCTCAGACCAGTACT
CGGATTACAGCTACAAGACCAATCAACCAAAATACAGCAC
AAAAACGCTCCCGCATCGCAGAGTGACGTTCTCCACAGCC
AACCCGATGCAAGATCAGCAGGACTCGTCTCAGCAGAGTT
ACTATGACAGTGGCTTGGAGGAGTCTGAGACCCCCAGCAG
CAAGAGTTCTTCAGGACCACGTATTGGGCCCCTCGCTCTA
CCTGAGGACCACTACGAAAGGACCACCCCCGATGGTAGCA
TCGGAGAGATGGAACACCCTGAAACCGATATTCGTTCGTT
GCCTGATGTTGCCATGACGGGGAACTGCAGTCAGGAGTGC
AGCGAGCTGGGTCACTCAGATGCTTGTTGGATGCCCGGTC
AGCCTTCGCCTGTTCGCAAGACCCGCAACCCCCCTAAACT
GTCCACGTTTGTGCCTTATCAGGAGAGGGGGAGCCTGGGA
CGCCTGGCCAATGGGAGTGTGAGGCTGGGAGGAGATGAGA
ACAGGCCACGCCTCCCACCTTCCCGTAGTGCCTACTCCAG
TAGTGAGCACGCCCCCAGTGACCACGCCCCACTGGAGGAG
GTGCCTCTGAGTGTGACATCAGAGTTCCCGCCTACCAGCC
CCCCCTCCAATCACGCCTCGAAAAGAGAGATTTACCTGTG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations