ZFIN ID: ZDB-TSCRIPT-091110-852
Transcript Name: urm1-202
Previous Names: ddx55-001, urm1-001, dkeyp-68f6.2-001, si:dkeyp-68f6.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042986 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042986|OTTDARG00000030929|ZDB-GENE-091204-300 urm1|OTTDARP00000034112 DKEYP-68F6.2-001 LG_ BX323065.6 Danio rerio protein_coding NOVEL, 962 bp
TTTCCTGAGGATGTGAGATTACTTCCGGGTTTTACAACAA
CATGGCAGCGCCCTTAGGTCTGCATCTGGAGTTTGGAGGA
GGAGCTGAGCTGCTATTTGATGGGGTCAAGAATCATCATG
TGACACTGCCTGACCAATCAAATCCCTGGGACATGAAGCA
GCTGCTGGCGTGGATCCGAGGGAACATGCTAAAGGAGCGC
CCAGAGCTTTTTATGCAGGGCGACACTGTTAGACCTGGGA
TTCTGGTATTGATTAACGACGCAGACTGGGAACTGATGGG
AGAATTGGACTACCAACTTCAGGACAAGGATAACGTTGTC
TTTATTTCCACACTTCATGGAGGCTAAACGACTCTAAAAG
ATACACCGCACCCATACAGGAGCCCCTTCACAATTCAAAA
GGTCAAATATTCGATGATCCATCAACAGCGGCATTGGTGA
CTGATTTAAGTTCCAGTTGTGGACTTCTCGACCAATCGAG
ACTTGTGAAAAGCTATTTTAGCTATAAGTCTAAAGTGTAT
AATGTCGTTGGGAATCTGGCGTTGGAGGGACAGTTCACTG
TCCCATGTACCTTTCAGGAGTGTGGCGGGGTTACGATGGA
GAGCAAGGGCTCATTAAGAAGGTCACCCTGTCTAGCCAGT
GTCCAGATGGATTCTCTTGAGACATGGTGGACCGATTGCC
CCATGTCAAATGGCTCCGTTATAATTTTCTTTTCGATGCC
TTTTCAGTTCTATCTACCTTTTATACATAAAAGTGCTTTT
ATGTATAATCTGAATAAATTGTGGAAATATTATGTTTTTT
TTAATAGCACTAATGCCATATTAAATGTTGTCCAAGTTTA
AATTCACATTAGATGTTTTAGTATTAAAATGTAATTATCC
CTTCTATGCAGTACCTTAATGTTTTATATAGCATAAGCTT
ATCAATATAACTTTTGATAATATATTTTTAATATTTTTAC
AT

urm1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA urm1-201 (1)    Ensembl 858
urm1-202 962
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
urm1-202 Contained in:
[BAC] DKEYP-68F6 (1)

Genome Resources: Vega_Trans:OTTDART00000042986 (1),  Ensembl_Trans:ENSDART00000142895 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC056580 (1) 1600 nt
GenBank:EH549393 (1) 940 nt
GenBank:EH570513 (1) 924 nt
GenBank:CN502593 (1) 851 nt
GenBank:EH555959 (1) 846 nt
GenBank:EX159440 (1) 700 nt
CITATIONS (2)