ZFIN ID: ZDB-TSCRIPT-091110-1578
Transcript Name: urm1-201
Previous Names: ddx55-002, urm1-002, dkeyp-68f6.2-002, si:dkeyp-68f6.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042987 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042987|OTTDARG00000030929|ZDB-GENE-091204-300 urm1|OTTDARP00000034113 DKEYP-68F6.2-002 LG_ BX323065.6 Danio rerio protein_coding NOVEL, 858 bp
ACTTCCGGGTTTTACAACAACATGGCAGCGCCCTTAGGTC
TGCATCTGGAGTTTGGAGGAGGAGCTGAGCTGCTATTTGA
TGGGGTCAAGAATCATCATGTGACACTGCCTGACCAATCA
AATCCCTGGGACATGAAGCAGCTGCTGGCGTGGATCCGAG
GGAACATGCTAAAGGAGCGCCCAGAGCTTTTTATGCAGGG
CGACACTGTACCTGGGATTCTGGTATTGATTAACGACGCA
GACTGGGAACTGATGGGAGAATTGGACTACCAACTTCAGG
ACAAGGATAACGTTGTCTTTATTTCCACACTTCATGGAGG
CTAAACGACTCTAAAAGATACACCGCACCCATACAGGAGC
CCCTTCACAATTCAAAAGGTCAAATATTCGATGATCCATC
AACAGCGGCATTGGTGACTGATTTAAGTTCCAGTTGTGGA
CTTCTCGACCAATCGAGACTTGTGAAAAGCTATTTTAGCT
ATAAGTCTAAAGTGTATAATGTCGTTGGGAATCTGGCGTT
GGAGGGACAGTTCACTGTCCCATGTACCTTTCAGGAGTGT
GGCGGGGTTACGATGGAGAGCAAGGGCTCATTAAGAAGGT
CACCCTGTCTAGCCAGTGTCCAGATGGATTCTCTTGAGAC
ATGGTGGACCGATTGCCCCATGTCAAATGGCTCCGTTATA
ATTTTCTTTTCGATGCCTTTTCAGTTCTATCTACCTTTTA
TACATAAAAGTGCTTTTATGTATAATCTGAATAAATTGTG
GAAATATTATGTTTTTTTTAATAGCACTAATGCCATATTA
AATGTTGTCCAAGTTTAAATTCACATTAGATGTTTTAGTA
TTAAAATGTAATTATCCC

urm1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA urm1-201 858
urm1-202 (1)    Ensembl 962
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
urm1-201 Contained in:
[BAC] DKEYP-68F6 (1)

Genome Resources: Vega_Trans:OTTDART00000042987 (1),  Ensembl_Trans:ENSDART00000129952 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH457255 (1) 876 nt
CITATIONS (2)