Transcript

gnpda2-002

ID
ZDB-TSCRIPT-091110-789
Name
gnpda2-002
Previous Names
  • dkey-185e18.2-002
  • dkeyp-45e9.3-001
  • ottdart00000038636
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038636 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038636|OTTDARG00000028396|ZDB-GENE-091117-41 gnpda2|no_translation DKEY-185E18.2-002 LG_ BX088718.8 Danio rerio protein_coding NOVEL, 751 bp
GACCAGTGTTTTCAAAGAAAACTTGCACCCATTCACCCAA
CCCGCTCGTGGCTGAGATCCTGCGTTTTATTACATCTTCA
GGCTGCACGGTGTCCTGCTATCAGTGAAAAGTCATGAGAC
TTGTGATTCTGGATGACTATGATCTGGCCAGCGAATGGGC
TGCAAAGTACATCCGCAACCGGATCATCCAGTTCAAACCC
AGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTA
GCACACCTCTTGGCTGCTATAGGAAACTGATTGAGTATCA
CAAAAGCGGAGACCTGTCCTTTAAATATGTGAAGACCTTT
AACATGGACGAGTATGTGGGTCTGCCCAGAGATCATCCAG
AGAGCTATCACTCCTACATGTGGAATAACTTCTTCAAGCA
CATCGACATTGAACCCCAAAACACTCATATACTGGACGGC
AACGCCAGCAACCTGCAGACCGAGTGCGAGTCCTTCGAGC
AGAAGATTAGTGCTGCTGGAGGCATCGAGCTCTTTGTGGG
AGGCATTGGTCCAGATGGGCACATCGCCTTTAATGAGCCT
GGCTCCAGTCTCGTGTCCAGGACCCGAGTGAAGACGCTGG
CCAAGGACACTATAGTAGCCAATGCACGCTTCTTTGGAAA
CGATCTTTCCAAAGTGCCCACCATGACTCTAACAGTTGGA
GTAGGAACAGTGATGGATGCCAGAGAGGTAAATAAAAGTA
TAGCTGATCATCTTAAGTTCAGGTATTAAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations