ZFIN ID: ZDB-TSCRIPT-091110-789
Transcript Name: gnpda2-002
Previous Names: dkey-185e18.2-002, dkeyp-45e9.3-001, ottdart00000038636

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038636 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038636|OTTDARG00000028396|ZDB-GENE-091117-41 gnpda2|no_translation DKEY-185E18.2-002 LG_ BX088718.8 Danio rerio protein_coding NOVEL, 751 bp
GACCAGTGTTTTCAAAGAAAACTTGCACCCATTCACCCAA
CCCGCTCGTGGCTGAGATCCTGCGTTTTATTACATCTTCA
GGCTGCACGGTGTCCTGCTATCAGTGAAAAGTCATGAGAC
TTGTGATTCTGGATGACTATGATCTGGCCAGCGAATGGGC
TGCAAAGTACATCCGCAACCGGATCATCCAGTTCAAACCC
AGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTA
GCACACCTCTTGGCTGCTATAGGAAACTGATTGAGTATCA
CAAAAGCGGAGACCTGTCCTTTAAATATGTGAAGACCTTT
AACATGGACGAGTATGTGGGTCTGCCCAGAGATCATCCAG
AGAGCTATCACTCCTACATGTGGAATAACTTCTTCAAGCA
CATCGACATTGAACCCCAAAACACTCATATACTGGACGGC
AACGCCAGCAACCTGCAGACCGAGTGCGAGTCCTTCGAGC
AGAAGATTAGTGCTGCTGGAGGCATCGAGCTCTTTGTGGG
AGGCATTGGTCCAGATGGGCACATCGCCTTTAATGAGCCT
GGCTCCAGTCTCGTGTCCAGGACCCGAGTGAAGACGCTGG
CCAAGGACACTATAGTAGCCAATGCACGCTTCTTTGGAAA
CGATCTTTCCAAAGTGCCCACCATGACTCTAACAGTTGGA
GTAGGAACAGTGATGGATGCCAGAGAGGTAAATAAAAGTA
TAGCTGATCATCTTAAGTTCAGGTATTAAGG

gnpda2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gnpda2-201 (1)    Ensembl 4850
ncRNA gnpda2-002 751
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gnpda2-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038636 (1),  Ensembl_Trans:ENSDART00000038301 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH505240 (1) 778 nt
GenBank:EH531415 (1) 755 nt
CITATIONS (2)