Transcript

gnpda2-201

ID
ZDB-TSCRIPT-091110-56
Name
gnpda2-201
Previous Names
  • dkeyp-84g6.2-001
  • gnpda2-001
  • dkey-185e18.2-001
  • ottdart00000038635
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038635 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038635|OTTDARG00000028396|ZDB-GENE-091117-41 gnpda2|OTTDARP00000030953 DKEY-185E18.2-001 LG_ BX088718.8 Danio rerio protein_coding NOVEL, 4850 bp
GTTTTCAAAGAAAACTTGCACCCATTCACCCAACCCGCTC
GTGGCTGAGATCCTGCGTTTTATTACATCTTCAGGCTGCA
CGGTGTCCTGCTATCAGTGAAAAGTCATGAGACTTGTGAT
TCTGGATGACTATGATCTGGCCAGCGAATGGGCTGCAAAG
TACATCCGCAACCGGATCATCCAGTTCAAACCCAGTGCTG
ACCGCTACTTCACTTTAGGACTTCCAACAGGTAGCACACC
TCTTGGCTGCTATAGGAAACTGATTGAGTATCACAAAAGC
GGAGACCTGTCCTTTAAATATGTGAAGACCTTTAACATGG
ACGAGTATGTGGGTCTGCCCAGAGATCATCCAGAGAGCTA
TCACTCCTACATGTGGAATAACTTCTTCAAGCACATCGAC
ATTGAACCCCAAAACACTCATATACTGGACGGCAACGCCA
GCAACCTGCAGACCGAGTGCGAGTCCTTCGAGCAGAAGAT
TAGTGCTGCTGGAGGCATCGAGCTCTTTGTGGGAGGCATT
GGTCCAGATGGGCACATCGCCTTTAATGAGCCTGGCTCCA
GTCTCGTGTCCAGGACCCGAGTGAAGACGCTGGCCAAGGA
CACTATAGTAGCCAATGCACGCTTCTTTGGAAACGATCTT
TCCAAAGTGCCCACCATGACTCTAACAGTTGGAGTAGGAA
CAGTGATGGATGCCAGAGAGGTGATGATTTTGATCACGGG
GGCTCACAAGGCCTTTGCCCTGTATAAAGCCATCGAGGAG
GGGGTGAACCACATGTGGACGGTCTCTGCCTTCCAGCAGC
ATCCACGGACCATTTTTATTTGCGATGAAGATGCAACGCT
GGAGCTCAGGGTCAAAACCGTGAAGTATTTTAAAGGCCTG
ATGCACGTCCACAATCAGCTAGTGGAACCGACGCTCAGCG
TGAAGGACTACATGGATTAATAAATGGCTGAAATCGCAAC
AACATTGATGTGAATGAGTGATGACTGGCCTCGGGGACCA
CAGCAGTCTTAATGTGTTTATAAGTCTACACCAGCATAAC
AGGTAGACGTCGTGCCATATTCACCCACTCCAGTTGAAAG
CCTTTGGGGTTCATTTGTAGGCCAGCGTATAAAGGGATCG
TCAGATACACTCTTTCTTTCTTTACGTCTCCTGTTTTGGA
TGACGCTACAACAGTCCTTGAATCACTAATTAAAAAAAAC
TAATCTGTTACACTCCCTGTTTTCATTCTGAGAAAGTGCA
TCTGTCATTAAATCTGTACTGTAGTTTAAAGGAACAATCT
ACTTTTTTTTTGGAGGGAGAAATCCTTTATAAATCCAAGT
CCATTACAGTTAAATAGTTGAGTTTTACCATTTTTAATCC
ATTCAGTCAATCTCTGAGTCTTGCAAAAGCAATTTTAGCT
TAGCATAATGCATTGAATTGGATTAGACCATTAGCATGTT
TTCATTTTACAAATTTATTAGAGTTAAATAGTAGAGTTTT
ACCATTTTTAATCCATTCAGCCAATCTCTGAGTCTTGCAA
AAGCACTTTTAGCTTAGCATAATGCATTGAATTGGATTAG
ACTATTAGCATGTTTTCATTTTACAAATTTATTAGAGTTA
AATAGTTGAGTTTTACCATATTTAATCCATTAAGCCGATC
TCTGAGACTTGCAAAAGCACTTTTAGCTTAGCATAATGCA
TTGAATTGGATTAGACCATTAGCATCTTTATATTTTACAA
GTTCATTAGAGTTAAATAGTTGAGTTTTACCATTTTTAAT
CCATTTAGCCAATCTCTTGAGTCTTGCAAAAGCAATTTTA
GCTTAGCATAATGCATTGAATTGGATTGGACCATTAGCAT
GTTTTCATTTTACAAGTTTATTAGAGTTAAATAGTTTAGT
TTTACCATTTTTAATCCATTAAGCCGCTCTCTGAGTCTGG
CGGAAACACTTTTAGCTTAGCATAATGCATTGAATTGGAT
TGGACCATTAGCATGTTTTCATTTAACAAGTTCATTAGAG
TTAAATAGTTGAGTTTTACCATTTTTAATCCATTCAGCTG
ATCTTTTGGTCTGGCGGAAGGACTTTTAGCTTAGCATAAT
GCATTGAATCGGATTAGACCATTACCATCTTTTCATTTTA
CAAGTCCATTACTGGCAAATACTTGAGTTTCACAATTGTT
ATCCATTCAGCTGATCTATTGGTCTTGCGGAAGCACTTTT
AGCTTAGCAAAGCAAAATGCATTGAATCAGATTAGACCAT
TAGCATCTTTTCATATTTCAAGTCCATTACAGTTAAATAG
TTAAGTTTTACCATTTTTAATCCATTCAGCTGATCTCTTG
GTCTGGCGGAAGCACTTTTAGCTTGGCTTAGCATAATGTG
GTAAATCGGATTAGACCATTAGCATCTTTTCATTTCACAA
CTCCTCCACAGTTAAAGAGTTGAGGTTTACAATTTTTGAG
GGCATTTAGACAGTCTTTAGGTCTAGCGGGAGCACTTTTA
GCTTAGCATAGATCATTGACTCGGATTAGACCATTAGCAT
CTTGCCAAAAAAATCTATTTTTCACTAAATGATGTGAACA
TTCCTAAATGTTCTTCCTATAGTCAAGTGTGTGTTTATGG
ATTCAGGCTTAACACTAAATAATATTCAAAAATGACCCGG
ATAGTCAATTATTTCCGGTTGAAATTTCAAGTGCAGTGGC
CTACTTAATAGACCTACTTAAAGTAACACTTTCCTTTTTT
GGAAATAGAATTATTTTACTATTAAGCTAGAGGTAAATGG
TTTAGTTTCATGGGGTATGGCAGGAACACTTTTAGCTTAG
CTTAGCATAAATCATGAAATCAAATTAGACCATTAGCATC
TCGCTTAAAAAAATAAAAATAATAATGTCTTGATCATTTT
TCTATTTAAAACTGGACTCTTCTCTTGACATATTATGTAC
TAAAACAGATGAAAAATGAAAAGTTGCTATTTTCTTTGCT
AATAGGCTAGGAACTACACTCTTATTCTGGCATAATAATC
AAGGGACTATGCTGACGTATCATAGTTGCATTTGAAAATA
GTCCCTAACTTGGTAACAATGTTGCATCAAGCTTTAAATA
GTAAAATCATTGACATGCTAATGGTCTAATCTGATTCAAT
GCATTATGCTAAACTAAGCTAAAAGTACTACAACCAGACT
CAGAGATCGGCTGAATGGATTAAAAATGGTAAAAATCGAC
TATTTAACTGTTATGGACTTGTAAAATAAAAAGATGCTAA
TGGTCTAATTTGATTTAATGCATTATGCTAAGCTAAGGTA
AAAATGCTACCGCCAGACCAAAAAAATCAGCTGAATGGTT
TAAAAATGGTAAAACTCAATTATTTAACTGTAATGGACTT
CTAAAATAAAAAAGATGCTAATGGTCTAATATGATTTAAT
GCATTATGCTAAGCTAAGCTAAAAGTGCTTCTGTCAAACC
AAGAGATCATCTGATTGGATTAAAAATTGTAAAAATCAAC
TATTTAACTAATGGACTTGCAAAATGAAAAGATGCTAATG
GTCTAATCCAATTCAATGTATTATGCTAAGCTAAGCTAAA
AGTGCGTCTGTCAAACCAAGAGATTGGCTGAAAAGATTAA
AAATGGTAAAAATCAACTATTTAACTGTAATGGACTTGTA
AAATAAAAAGATGCTAATGGTCTAATCTGATTTAATGCAT
TATGCTAAGCTAAGCTAAAAGTGCTTCTGTCAAGCCAAGA
GATCGGCTGAATAGATAAAAAATGGTAAAACTTAATTATT
TAAATGTAATAGACTTGTAAAATAAAAAAGTGGAGTGTTC
CTTTAAGCAGGAAATACCGAAGGTCAAAATTGCAAGCCAA
ACATCTGTTTTCACTGATGATGCTCGTTTTTTATTGCACA
GGAATTTACTTTGAGGTTGTTTTGAATTGGTAGCACTGCA
GTAAGGTTCTATTAAAGTTAATGTATTTAGTAAAATTAAA
TAAACAATGCATTTATTACAGTATTTACTCATTGTTTTAA
ACTTTAGTTAAAGAACATAAAGTCATTCATCGTTAGTTAA
CTCACAGCGCATTAACGAATGTTAACAAGCACATCTTTGG
ATTTCCATAATGTATTAATCAAACTATAGAAAACGAATGC
AGCACAAATATTTTCATTTCGAGTTGATGTCAGTGAATAC
ATTAACTGATGGAACATTATTGTAAAGTGTGCCCTTCATT
TTTTTGGTAAACCTTTTGTTTAAGGATCTATCTCTGTTTA
AATGAGACCTTACAGATTGATTAGACATCATATTTGATAA
ATACAAGCTGTGGTGGCTGATCTGTGATCAGATGTTCCGA
CTTTAAAATGTTTTAGTAGTATAGTGACATTTTATACAAC
TTCAAGCACATTTTGTTGCTTTTAATTGAATCCAGGTTAC
TTGCCGCATGCAAAACCAGTAAAAGAAAGCAGATGAAGCA
GTGTTTGTCTTGTTTGCTTGCATTTAAATTGGTTTTAGCA
CATCTAATTAGAGAAGTGTTCGTTTTGCATTTAACCATTT
TCCCTCATATGATGATGTGCTGTACTGTATTCTCTTTAGT
TACTGTACTTTGTGATATACAAATGGTTACTCATAATGTA
TATATTTCATCTCACATTGTGGCTTTTCTTTCTGGTGTTT
CTAAACCCTCCTGTTCTGTACTTCAATGAATGTTCATGAG
GAGGAAAATACACATTTTTTTATGCATTTACATGTTTACT
TCAAATAAACTCTTAAAGGAAATGTAAACCGACTGTTAAA
CTGGATTTACACTCCAAAATCCAAATCCTCCTCTTTCTGT
ATTTTTTAATTAAAGAATAAATAAAGGTTTGTTTTATCGT
CGCCCAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations