header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-716
Transcript Name: ttc39a-202
Previous Names: ttc39a-002, ch211-77o19.1-001, ch73-196i15.3-003, ottdart00000045487, si:ch211-77o19.1-001, si:ch211-77o19.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045487 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045487|OTTDARG00000032543|ZDB-GENE-091116-42 ttc39a|OTTDARP00000035919 CH211-77O19.1-002 LG_none CT025878.17,CU467093.10 Danio rerio protein_coding KNOWN, 842 bp
ACATGCTAAAAAAAAAGCACAGACACACACGGCCGCTGTT
GCTTCTCCAGCAGAAGTTCAGCGATCACCTGTGGGACTGT
AGGCGAGGACAGGTAACGAATGTCCAGGTGACTCTCTCTC
ACACTCTCTACGCTCTTGCTGGATTCACAATCCTCTCTAC
TCGTCTGGGATGAGTTTCTGGAGACGAAACAAGAAGAATG
ACGACCAAAAGAATCAACTCAAAACTGAAGAGTCACTGGA
CAGCCCCACATCTCCATCCCACAGGGTGGATTACCGTAAC
AGCCTCCTCACTGGCCTTCCCACAAAGACAGTCAGACAGT
TGCAGCTCATCCAGAACGCTGCTCCCAGGATTCTGCCAAG
AACCAGAAAGTCACCTATTATAGAGAAAGATGGTTTGGAC
TCTGTCATCTCTGATTACGGGTCAGAAAAGCCTGACCTGT
CCGCGGATCTTCAAGACTGCATGGCTGCACTGGACCTGTT
CCTGCAAAATCAATTTGACGAGTCTCTGAGCAGACTACGA
AGCAGGAATAAAGACAGCATGTATCACGCGCTCACGTATG
CCACTATACTGGAAATGCAGGCCATGATGACCTTCAACCC
GGAGGACATATTTGCTGCAGGAAACACAATGAAGGAGGCA
CAGGCTGTGTGTCAACGATACCGCAAAAAGTCTTCATTCA
ACAGCAAAAACTTCACCGAAGAGGAGCTTCATGCTGAAGT
GTGCTATGCCGAATGCCTCCTCCAGAGAGCAGCACTCACT
TTCCTTCAGGATGAAAATATGATCAGCTTCATAAAGGGAG
GAATGAAAGTGAGAAACAGCTATCAAATATACAAGTAAGA
TT

ttc39a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ttc39a-202 842
ttc39a-203 (1) 2600
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttc39a-202 Contained in:

OTHER ttc39a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045487 (1)
  • Ensembl_Trans:ENSDART00000132681 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN013841 (1) 935 bp
    CITATIONS (2)