header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1439
Transcript Name: ttc39a-203
Previous Names: ttc39a-001, ch211-77o19.1-002, ch73-196i15.2-001, ottdart00000045488, si:ch211-77o19.1-001, si:ch211-77o19.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045488 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045488|OTTDARG00000032543|ZDB-GENE-091116-42 ttc39a|OTTDARP00000035920 CH211-77O19.1-001 LG_none CT025878.17,CU467093.10 Danio rerio protein_coding KNOWN, 2600 bp
ACATGCTAAAAAAAAAGCACAGACACACACGGCCGCTGTT
GCTTCTCCAGCAGAAGTTCAGCGATCACCTGTGGGACTGT
AGGCGAGGACAGGTAACGAATGTCCAGGTGACTCTCTCTC
ACACTCTCTACGCTCTTGCTGGATTCACAATCCTCTCTAC
TCGTCTGGGATGAGTTTCTGGAGACGAAACAAGAAGAATG
ACGACCAAAAGAATCAACTCAAAACTGAAGAGTCACTGGA
CAGCCCCACATCTCCATCCCAGTCACCTATTATAGAGAAA
GATGGTTTGGACTCTGTCATCTCTGATTACGGGTCAGAAA
AGCCTGACCTGTCCGCGGATCTTCAAGACTGCATGGCTGC
ACTGGACCTGTTCCTGCAAAATCAATTTGACGAGTCTCTG
AGCAGACTACGAAGCAGGAATAAAGACAGCATGTATCACG
CGCTCACGTATGCCACTATACTGGAAATGCAGGCCATGAT
GACCTTCAACCCGGAGGACATATTTGCTGCAGGAAACACA
ATGAAGGAGGCACAGGCTGTGTGTCAACGATACCGCAAAA
AGTCTTCATTCAACAGCAAAAACTTCACCGAAGAGGAGCT
TCATGCTGAAGTGTGCTATGCCGAATGCCTCCTCCAGAGA
GCAGCACTCACTTTCCTTCAGGATGAAAATATGATCAGCT
TCATAAAGGGAGGAATGAAAGTGAGAAACAGCTATCAAAT
ATACAAGGAGCTTCATACGATCCTGAAATCTTCAGGTTAT
GTTCAAGGTGACAATCATGGTCATTTTGAGGGAGGTGTTA
AACTCGGCATCGGGGCCTTTAACCTGATGCTGTCGTTGTT
GCCAACGCGGACTCTCAGATTGTTGGAATTTGTGGGCTTT
TCTGGTAACAAAGAGTTTGGTCTTGAGCAGCTCCAGGAGG
GCTGTTCTGAGCACACGTTTAGGTCTTTCCTGTGTAACAT
GTTGTTGCTCTGCTACCACACCTTCATGAGCTTCATTCTG
GGCACTGGAGAGGGGGATGTGGAAGATGCAGAAAAACTGC
TTCAGCCTTATCTGAAAAAGTATCCGAAGGGATCCATTTT
CCTGTTCTTCGCTGGTCGAATAGAGGAAATTAAAGGAAAT
CTGGATGCTGCTATCAAGCGTTTTGAGGAGTGTTGTGAAG
CTCAGCAGGACTGGAAACAGTTCCATCACATGTGTTACTG
GGAGCTGATGTGGTGCTTCACCTACAAAAGGCACTGGAAG
ATGGCCTACTTCTACGCAGACCTGCTCAGTAAAGAAAACA
ACTGGTCTAAGGCCACATATGCGTATATGAAAGGTGCTTA
CCTCAGCATGCTGAGTCGAGAGGAATGCCAGCCGTTCGGG
GAGAATGAAGTGGCTTTGTTTAGGCAAGTTCCCAGTCTAA
AGCAAAAAATTGCTGGGAAATCGCTGCCCACAGAGAAGTT
TGCTATTAGAAAAGCCAGACGCTATAATACTGATAATGTC
ATTCCTCTTCCTGCACCTCCACTGGAGATGATGTATATCT
GGAACGGCTACACTGTGATCGGGAAGCACAAGGACCTGAC
AGAGGGCATGCTGAAGACATTGGATGAGGCCCAGCAGACG
CTTGAGCAAACTCCAAGGACTGAGTTCACCACAGATGACC
AGTGTGTGGTTAGTTTGCTGAAGGGCCTCTGTCTCAAACA
CTTGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTC
GTCCTCTGCAATGAGAGTCTGATTAAATATGACCACTACC
TGGTGCCCAATGCATTGCTGGAACATGGGTTACTGTGCTT
GGAGGAGGGGAGAATAGATGAAGCCATCAAACTTCTGGAG
GCCGCAAAACAAAACTACAAGAACTACTCCATGGAATCCC
GAACACACTTCCGGATTCAGGCAGCTCTACATAAGGCCCG
AGGCACAGCTGTGAACGGATACCATTCCTCACCTTCCAGC
CCTTAACACTTAGGGTTTCCGCTGGGTCACAGCAACTAAG
ATCAGGCTTGACATGGGTTGCCAAATGCCCTGAGAGGGAC
TAACAGAGTACATGACCCAAACCGAGCTTATAGTGACGTC
TCCTTGATTAAATAACGCATACAGAGATTTTTACTGTACA
TGGACAACAGCTGCATGAATATGTCACGTCAAGTGCCATG
CAATTTAGCCAAGACCCAGAAATGACATCATGCTGTTGTG
ATGTCATGAAAATAACATCATGCTTTTAGAATATTGTACT
TGTGTTGTTAATAGGGAGGATGACGATAATGATATGAAAC
ACAATGTTAGGAGTGTAACAGTATGCATATTCATTCATTC
ATTTCTTTTCCTTAAGCTTAGTCTCTATTTTAGAGATTGC
CACAGCGGAATGAACCGCCAACTATTCCGGCATATGTTTT
ACGCAGCGGATGCCCTTCCAACCGCAACACAGTACTGGGA
AACACCCATACACACTCATTCACACACATTTATACACTAC
AGCCAATTGAGTTTATTCAGTTCACCTATGCCACATGTCT
GTGGATTGTGGGGGCAACTGCAGCAGCTGGAGGAAACCCA
CGTTGACACGGAGAGAACATGCAAACTCCTCACAAAAATG

ttc39a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ttc39a-202 (1) 842
ttc39a-203 2600
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttc39a-203 Contained in:

OTHER ttc39a-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000045488 (1)
  • Ensembl_Trans:ENSDART00000146469 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EL650397 (1) 964 bp
    GenBank:DV592722 (1) 775 bp
    CITATIONS (2)